MicroRNA Mimic Negative Control - BioReagent, ≥90%(HPLC) , CAS No.M659388

CAS: M659388 Cat. No.: M659388 Peso molecolare: 13332.58

GRADE & PURITY BioReagent, ≥90%(HPLC)

Synonyms

miRNA mimic negative control | miRNA mimic NC | Negative control mimic | Scramble mimic | Scrambled miRNA mimic | Non-targeting miRNA mimic | Nonspecific miRNA mimic | Control mimic | miR-NC mimic | miR-scramble | NC mimic

Storage

Store at -20°C,Avoid repeated freezing and thawing

Shipped In

Ice chest + Ice pads

Panoramica

MicroRNA Mimic Negative Control is a 22-nucleotide miRNA mimic and serves as a negative control.

Purification: HPLC

Sense sequence (5'→3'): UUUGUACUACACAAAAGUACUG

Antisense sequence (5'→3'): GUACUUUUGUGUAGUACAAAUU

Specifications

Sinonimi

miRNA mimic negative control | miRNA mimic NC | Negative control mimic | Scramble mimic | Scrambled miRNA mimic | Non-targeting miRNA mimic | Nonspecific miRNA mimic | Control mimic | miR-NC mimic | miR-scramble | NC mimic

Specifiche e purezza

BioReagent, ≥90%(HPLC)

Stabilità e conservazione

Store at -20℃ long term (12 months). Upon reconstitution, it is recommended to aliquot. Avoid freeze/thaw cycle.

Condizioni di conservazione di stoccaggio

Store at -20°C,Avoid repeated freezing and thawing

Spedito in

Ice chest + Ice pads

Questo prodotto richiede spedizione a catena fredda. I servizi di terra e altri servizi economici non sono disponibili.

Grado

BioReagent

Purezza

≥90%(HPLC)

Nomi e identificatori

• Peso molecolare: 13332.58

Domande frequenti

What is the purity of this product, and how is it determined?

This product is supplied at ≥90% purity, determined by HPLC. Lot-specific values are stated on the Certificate of Analysis.

What does BioReagent mean?

BioReagent indicates that the product has been processed and tested for biological and biochemical applications. Specifications may include endotoxin limits, microbial controls, sterility, low DNase/RNase/protease activity, and verified biological activity where relevant.

How should this product be stored?

Store at ?20 °C. Avoid repeated freeze–thaw cycles. Aliquot into single-use volumes before freezing.

How is this product shipped?

This product ships in an insulated container with ice pads. Unpack on arrival and transfer it to the storage condition stated above.

What are the CAS number, molecular formula and molecular weight?

The CAS Number is M659388, and the molecular weight is 13332.58 g/mol.

What documentation is provided?

Available product documentation, including Certificates of Analysis (COA), Safety Data Sheets (SDS), and specification sheets, is shown in the product document area. Document availability and access follow the current site policy.