≥98% for sensitive chromatographic and analytical workflows requiring minimal baseline interference.
🌡
Storage & shipping
Store at -20°C,Desiccated Ships Ice chest + Ice pads Check lot-specific COA for exact specifications.
📋
Quality documents
SDS, COA, datasheet, and spec sheet available for download. Lot-specific COA accessible via lot number lookup.
📚
Literature proof
Cited in 0 peer-reviewed publications across chromatography, organic synthesis, and cross-coupling reactions.
Descripción general
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC).
Specifications
Especificaciones y pureza
≥98%
Condiciones de almacenamiento de almacenamiento
Store at -20°C, Desiccated
Enviado en
Ice chest + Ice pads
Este producto requiere envío en cadena de frío. Los servicios terrestres y otros servicios económicos no están disponibles.
Tipo de acción
INHIBITOR
Pureza
≥98%
Nombres e identificadores
Peso molecular
7762.00
Documentation
📋 Safety Data Sheet (SDS)
Comprehensive hazard, handling, storage, and regulatory compliance document.
We use cookies to ensure the website functions properly and, where permitted, to improve your experience. You can manage your preferences at any time in Settings. Learn more in our Cookie Policy.
Shall we send you a message when we have discounts available?
Remind me later
Thank you! Please check your email inbox to confirm.
Products are supplied to verified businesses, institutions, and qualified professionals for research and development use only. Not for use in humans, animals, diagnosis, or therapy.