Protocols

Identification of chordoma-associated genes and screening experiments

Summary

Chordoma-associated gene identification and screening assays for (1) molecular mechanisms of chordoma (2) gene diagnosis (3) gene therapy.

Operation method

mRNA differential display method

Principle

Eukaryotic mRNAs have a cap structure at the 5' end and a poly(A) tail about 200 bp long at the 3' end. According to this feature, a complementary sequence oligo dT can be designed, and in order to anchor it at the beginning of the poly(A) tail, it is designed as T12MN (M=A/C/G; N=A/T/C/G), so that there are 12 different combinations of T12MN. By using T12MN as a reverse transcription primer, the mRNA with poly(A) tail can be reverse transcribed into the corresponding cDNA, and then the primer is anchored to the 3′ end of the second strand of the cDNA, and then a random primer is introduced for PCR amplification. Since the random primer randomly binds to the complementary target site of the cDNA, the amplified fragments originating from different mRNAs are of different sizes, so the products amplified by PCR are of different sizes. As the random primers randomly bind to the complementary target site of the cDNA, the amplified fragments originating from different mRNAs are of different sizes, so the products amplified by PCR are also of different sizes. After verifying that the fragments are specific, the cDNA library can be screened or the full-length cDNA can be obtained by Rapid Amplification of cDNA End (RACE).

Materials and Instruments

18 specimens of chordoma and its surrounding normal tissue (more than 5 cm from the tumor)
Agarose TBE electrophoresis buffer Electrophoresis loading buffer Ethidium bromide (EB) solution mother liquor DNAGreen Trizol reagent
PCR instrument Tubes Pipettes Guns Tips Cartridges Water baths Automated gel electrophoresis imaging analyzers

Move

I. Material preparation
1. Specimens
Eighteen specimens of chordoma and its surrounding normal tissues (more than 5 cm away from the tumor) were obtained from the Department of Orthopedics of the First and Second Affiliated Hospitals of China Medical University, the Liaoning Provincial People's Hospital, and the Shenyang Central Hospital, and were diagnosed as chordomas by pathology sections, and were placed in liquid nitrogen for quick-freezing immediately after the removal of the material, and then stored in -7O℃ refrigerator for spare use. The mRNA-DD test in this studyThe specimen used in the mRNA-DD test in this study was No. 15, taken from the First Hospital of China Medical University (2000-10-20), a 60-year-old male patient with pathology No. 328874.
2. Primers
Anchored primer (HIEROGLYPH):T7(dT12)AP8 5 ACGACTCACTATAGGGCrITITTrrrrrrIT丌AA3T7(dT12)AP11 5 ACGACTCACTATAGGGCTT1Tn T 几TIrrAT3
Random primer (Arbitrary primer, HIEROGLYPH):M 13r-ARP1: 5 ACAArITITCACACAGGACGACTCCAAG3M 3r-ARP2: 5 ACAArITITCACACAGGAGCTAGCATGG3M13r-ARP3: 5 ACAArITITCACACAGGAGACCATrGCA3M13r-ARP4: 5 ACAArITITCACACAGGAGATAGCAGAC3
II. Total RNA extraction Total RNA was extracted by applying Trizol reagent (GIBCOBRL).
Reverse transcription 1 ug of total RNA was taken and reverse transcribed using GIBCOBRL's Reverse Transcription Kit. 20 ul of PCR reaction system was used, and the primers were 1_7(dT12) APs, the conditions are shown in the kit.
DD-PCR amplificationThe primers were M13r-ARPs, the system was 10 ul, and the PCR amplification conditions were: 95°C for 30 s, 50°C for 40 s, 72°C for 2 min, 5 cycles: 95°C30 s, 60°C 40 s, 72°C 2 min, 31 cycles.
V. Product detection3 ul of product was taken for 8% polyacrylamide gel electrophoresis (50°C , 3000 V, 100 W, 4-5 h) and scanned by GenomyxLRTM Fluores-cent Imaging Scanner. Then the difference bands were cut off.
VI. Purification, sequencing, homology comparison and analysis of differential cDNA fragmentsDifferential bands were re-amplified by PCR under the same conditions as DD-PCR with 10.0 ul. The purified cDNA fragments were sequenced (Shanghai Sangong Biotechnology Co., Ltd.), and the sequencing results were compared and analyzed for homology on the Internet.
VII. Validation of differential cDNA fragments
Based on the sequencing results of the two differential cDNA fragments, a pair of specific primers (amplifying two fragments of 507 bp and 448 bp) were designed respectively, and RT-PCR reaction was carried out using the total RNA of the same chordoma patient as the template. The replication temperatures of the two pairs of specific primers were 58°C (cDNA1) and 60°C (cDNA2), and the primer sequences were as follows:
cDNA 1: TCTGCCACATCTrGGCCrITITCAACCTCTGCTFCCCAGGCTcDNA 2: AACAGCCCTCAGCATrGGCTATGCCCAGATGGAGCCTCTC
The sequence of B-actin (318 bp) primer used for internal control is as follows:MW 5, ATCATGrITITGAGACCTCCAACA3MW 5 CATCTCTFGCTCGAAGTCCA3
PCR reaction conditions: 94 ℃ for 30 s, 58 ℃ to 60 ℃ for 30 s, 72 ℃ for 1.5 min, 35 cycles. 2% agarose gel electrophoresis at 80 V for 60-90 min, and the results were analyzed by automatic gel electrophoresis imaging analyzer.VIII. Screening for the correlation between differential cDNA fragments and chordomaAccording to the method used in the validation experiment of differential cDNA fragments, RT-PCR screening of two differential fragments, cDNA1 and cDNA2, was carried out on the remaining 17 cases of chordoma and their surrounding normal tissues.

Caveat

The second generation is the restriction enzyme fragment difference display technology, which is also called RFDD-PCR. restriction enzyme fragment difference display (RFDD-PCR) is a very effective improvement to the traditional ddrtpcr corresponding to liangpeng's invention. RFDD-PCR is not to amplify the cDNA directly, but to restriction enzyme excision of the cDNA first, and then add special junctions to the cDNA fragment on both sides of the enzyme to amplify the cDNA. Instead of amplifying the cDNA directly, RFDD-PCR first restriction digests the cDNA, and then adds special joints on both sides of the digested cDNA fragment for amplification.

Common Problems

Sokolov et al. first used agarose gel electrophoresis with EB color presentation instead of polyacrylamide electrophoresis and shot autoradiography, which made the work much simpler. Cui Kairong et al. improved the method and used DD-PCR to successfully obtain three fragments with gene-specific expression in early somatic embryogenesis tissues of Lycium barbarum.

Reference: Han Zhuang, Experimental study on the identification and screening of chordoma-related genes by mRNA-DD method, China Cancer Clinics, 2005 , 32 (5) :287-289


For more product details, please visit Aladdin Scientific website.

https://www.aladdinsci.com/

Categories: Protocols
Explore topics: RNA Lab

Da — when not otherwise indicated, molecular weight units are daltons.   Mw — weight-average molecular weight.   Mn — number-average molecular weight.

Products are supplied for research and development use only. Not for use in humans, animals, diagnosis, or therapy.

Cite this article

Aladdin Scientific. "Identification of chordoma-associated genes and screening experiments" Aladdin Knowledge Base, updated 24 dic 2024. https://www.aladdinsci.com/us_es/faqs/identification-of-chordoma-associated-ge-en.html
Was this article helpful? Yes No 0 out found this helpful

Shall we send you a message when we have discounts available?

Remind me later

Thank you! Please check your email inbox to confirm.

Oops! Notifications are disabled.