≥93% for sensitive chromatographic and analytical workflows requiring minimal baseline interference.
🌡
Storage & shipping
Store at 2-8°C,Desiccated Ships Wet ice Check lot-specific COA for exact specifications.
📋
Quality documents
SDS, COA, datasheet, and spec sheet available for download. Lot-specific COA accessible via lot number lookup.
📚
Literature proof
Cited in 0 peer-reviewed publications across chromatography, organic synthesis, and cross-coupling reactions.
개요
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).
Form:Solid
Specifications
사양 및 순도
≥93%
생화학 및 생리적 메커니즘
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins . Bepirovirsen can be used for the research of chronic HBV infection . Bepirovirsen binding sit
보관 조건
Store at 2-8°C,Desiccated
배송
Wet ice
이 제품은 콜드 체인 배송이 필요합니다.지상 및 기타 경제 서비스는 사용할 수 없습니다.
작업 유형
INHIBITOR
순수함
≥93%
이름과 식별자
분자량
7344.00
Documentation
📋 Safety Data Sheet (SDS)
Comprehensive hazard, handling, storage, and regulatory compliance document.
We use cookies to ensure the website functions properly and, where permitted, to improve your experience. You can manage your preferences at any time in Settings. Learn more in our Cookie Policy.
Shall we send you a message when we have discounts available?
Remind me later
Thank you! Please check your email inbox to confirm.
Products are supplied to verified businesses, institutions, and qualified professionals for research and development use only. Not for use in humans, animals, diagnosis, or therapy.