≥98% for sensitive chromatographic and analytical workflows requiring minimal baseline interference.
🌡
Storage & shipping
Store at -20°C,Desiccated Ships Ice chest + Ice pads Check lot-specific COA for exact specifications.
📋
Quality documents
SDS, COA, datasheet, and spec sheet available for download. Lot-specific COA accessible via lot number lookup.
📚
Literature proof
Cited in 0 peer-reviewed publications across chromatography, organic synthesis, and cross-coupling reactions.
Übersicht
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC).
Specifications
Spezifikationen & Reinheit
≥98%
Storage
Store at -20°C,Desiccated
Verschickt in
Ice chest + Ice pads
Dieses Produkt erfordert Kühlkettenversand. Grundversand und andere Economy-Optionen sind nicht verfügbar.
Aktionsart
INHIBITOR
Reinheit
≥98%
Namen und Kennungen
Molekulargewicht
7762.00
Documentation
📋 Safety Data Sheet (SDS)
Comprehensive hazard, handling, storage, and regulatory compliance document.
Determine the necessary mass, volume, or concentration for preparing a solution.
Dilution Calculator
Determine the dilution needed to prepare a stock solution.
Reconstitution Calculator
Bewertungen
Kundenbewertungen
Häufig gestellte Fragen
What is the purity of this product?
This product is supplied at ≥98% purity (chemical assay). Lot-specific values are stated on the Certificate of Analysis.
How should this product be stored?
Store at ?20 °C, desiccated. Keep the container tightly closed with desiccant — the material is moisture-sensitive.
How is this product shipped?
This product ships in an insulated container with ice pads. Unpack on arrival and transfer it to the storage condition stated above.
What are the CAS number, molecular formula and molecular weight?
The CAS Number is 2563929-84-8, the molecular formula is C230H290N88Na19O115P19S19, and the molecular weight is 7762.00 g/mol.
What documentation is provided?
Available product documentation, including Certificates of Analysis (COA), Safety Data Sheets (SDS), and specification sheets, is shown in the product document area. Document availability and access follow the current site policy.
Wir verwenden Cookies, um die ordnungsgemäße Funktion der Website sicherzustellen und, soweit zulässig, Ihr Nutzererlebnis zu verbessern. Sie können Ihre Einstellungen jederzeit unter „Einstellungen“ verwalten. Weitere Informationen finden Sie in unserer Cookie-Richtlinie.
Dürfen wir Sie über Rabattaktionen informieren?
Später erinnern
Vielen Dank! Bitte überprüfen Sie Ihren E-Mail-Posteingang, um zu bestätigen.
Products are supplied to verified businesses, institutions, and qualified professionals for research and development use only. Not for use in humans, animals, diagnosis, or therapy.
