IHC sensitization test

Summary

There are several ways to increase the sensitivity of IHC. One is to rely on various IHC pre-treatments, such as enzyme digestion and antigen repair at high temperatures, which are practical, although the underlying principles are not well understood; and the second is to increase the magnification of the IHC method, mainly by increasing the amount of enzyme binding. Content from "Immunohistochemistry Experimental Techniques and Applications".

Operation method

rolling-cycle amplification method

Principle

Rolling circle amplification (RCA) is a method that can be used under constant temperature, so that the antibody (specific primary or secondary antibody) labeled with an oligonucleotide probe (no correlation with the nucleotides in the tissue cells) binds to the antigen in the tissue cells, and then under the action of DNA polymerase, the oligonucleotide added is amplified cyclically. After the antibody (specific primary or secondary antibody) binds to the antigen in the tissue cell, the added oligonucleotide undergoes cyclic amplification under the action of DNA polymerase, which produces an amplified DNA sequence copy product. At this time, the oligonucleotide labeled on the antibody is effectively amplified (109-fold), and the amplified product undergoes complementary hybridization with the oligonucleotide labeled with tracer added in a subsequent step, forming numerous hybrids with labeled tracer around the antigen-antibody, and then amplifying the tracer by the IHC method (see the principle in Fig. 5-6). This method is highly sensitive and specific.

Materials and Instruments

Oligonucleotides Paraffin sections Rabbit anti-FITC-AKP conjugate
GMBS Nitrogen Ellman's Reagent Specific Primary Antibody Potassium Glutamate PBS Nuclear Solid Red φ 29 Buffer φ 29 DNA Polymerase Tris-HCl (with MgCl, Levamisole)
PD-10 column Anion exchange column Q-sepharose

Move

1.1 Oligonucleotides for labeling antibodies

5'-AAAAAAAAAAAAAAAAATGATCACAGCTGAGGATAGGACATGCGA-3'


1.2 Circulation amplification oligonucleotides

5'-PCGCATGTCCTATCCTCAGCTGACAGAACTCACCTGTTAGACGCCACCAGCTCCAACTGTAAGATCGCTTAT-3'


1.3 Oligonucleotides for complementary detection with markers

5'-XACTGTGAAGATCGCTTATX-3', (X=biotin), or with 5'-F ACTCTCTGAAGATCGCTTAT F-3' (F=fluorescein); or with 5'-HRP ACTGTGAAGATCGCTTAT HRP-3' (HRP=horseradish peroxidase).


2. Binding of oligonucleotides to antibodies

The antibody used for conjugation can be a specific one-hanger, a second-hanger, or another conjugated secondary antibody. For example, anti-digoxin (Dig), anti-fluorescein (FITC), or antibiotic (biotin) secondary antibodies.


2.1 Desalting and activation of antibodies

Antibody immunoglobulin was first desalted and then antibody activation was performed by adding 410 mmol of GMBS [thio-N-(4-maleimidobutyryIoxy)thiobutanediimide. sulfo-N-(4-maleimidobutyryIoxy)sulfosuccinimide] to 41 nmol of antibody molecules, in the dark, at 37°C , in nitrogen for 30 min, transfer to room temperature and continue the reaction for 30 min, remove excess sulfo-GMBS with a PD-10 column (equilibrate the column with pH 7.5 PBS), and concentrate the activated antibody at 4℃. At this point, each antibody molecule contains multiple maleimides, and the amount of activated antibody can be titrated with Ellman's reagent, which primarily determines the sulfhydryl groups on the antibody molecule. The antibody is ligated to the oligonucleotide after activation.


2.2 Binding of activated antibody to oligonucleotides

Mix 28.1 nmol of sulfonated GMBS-activated antibody and 142 nmol of 5'-thiol oligonucleotide column in a total volume of 825 μl, and react for 2 h at room temperature, and then transfer to 4 ℃ for overnight reaction.


2.3 Purification of conjugates

Purification of the conjugates was generally carried out on an anion-exchange column Q-sepharose (column washed with a gradient of salts, followed by addition of samples, elution, and collection of the conjugates). The free oligonucleotides are then removed on a Sephadex G-200 column. The ratio of oligonucleotide to antibody in the purified mixture is 10:1, and in most cases, one antibody molecule can bind 3-5 oligonucleotides.


3. RCA immunohistochemical staining


3.1 Paraffin sections should be routinely deparaffinized to water and washed with PBS for 3×3 min after antigen repair.


3.2 Add specific primary antibody dropwise, incubate at 37℃ for 1 h, and wash with PBS for 3×3 min.


3.3 Add appropriately diluted oligonucleotide-labeled secondary IgG 200 nmol/L (diluted with 100 mmol/L potassium glutamate-PBS), incubate at 37℃ for 30 min, wash with PBS for 3×3 min, and wash with 100 mmol/L potassium glutamate.


3.4 循环寡核苷酸(170 mmol/L),用 φ29 缓冲液稀释 [缓冲液内含 250 mmol/L(pH 7.5)Tris-HCl,50 mmol/L MnCl2 ,1 mg/ml BSA,1 mmol/L dATP,1 mmol/L dCTP,1 mmol/L dGTP,0.75 mmol/ L dTTP, 0.25 mmol/L FITC-12-dUTP], 40 μl/slice, incubate at 37°C for 30 min without washing. Add 1 μl of φ29 DNA polymerase (0.4 U/μl) to each slice, continue the reaction for 30 min at 37°C, and wash with PBS for 3 × 3 min.


3.5 Rabbit anti-FITC-AKP conjugate 1:1000 dilution, 37 ℃ for 30 min; PBS wash 3 × 3 min; 0.02 mol/L Tris - HCl (pH 9.0 containing magnesium chloride, levamisole) wash 20 min.


3.6 NBT/BCIP staining was performed for 30-240 min.


3.7 Conventional gum sealing, results were observed.


For more product details, please visit Aladdin Scientific website.

https://www.aladdinsci.com/

Categories: Protocols

Shall we send you a message when we have discounts available?

Remind me later

Thank you! Please check your email inbox to confirm.

Oops! Notifications are disabled.