hsa-miR-181b-5p inhibitor - BioReagent,≥90%(HPLC) , CAS No.H1487881

CAS: H1487881 Cat. No.: H1487881 Peso molecular: 7635.5
Disponible para pedir
GRADE & PURITY BioReagent ? BioReagent grade — tested suitable for life-science and molecular-biology use. Use for cell culture, assays, and biochemical work needing biological compatibility. ≥90%(HPLC)
Storage
Store at -20°C,Avoid repeated freezing and thawing
Shipped In
Ice chest + Ice pads
 ·  off list, applied to all prices below.
Size
Estado
Price
Qty
5nmol
H1487881-5nmol
1-2 wks(?)
Item is derived from our semi-finished stock and is processed in 1-2 weeks.
109,90US$
20nmol
H1487881-20nmol
1-2 wks(?)
Item is derived from our semi-finished stock and is processed in 1-2 weeks.
259,90US$
Enter a quantity for the sizes you want to add.
🧪

Why this grade

BioReagent,≥90%(HPLC) BioReagent for sensitive chromatographic and analytical workflows requiring minimal baseline interference.

🌡

Storage & shipping

Store at -20°C,Avoid repeated freezing and thawing Ships Ice chest + Ice pads Check lot-specific COA for exact specifications.

📋

Quality documents

SDS, COA, datasheet, and spec sheet available for download. Lot-specific COA accessible via lot number lookup.

📚

Literature proof

Cited in 0 peer-reviewed publications across chromatography, organic synthesis, and cross-coupling reactions.

Descripción general

hsa-miR-181b-5p inhibitor is a chemically modified single-stranded oligonucleotide complementary to the sequence of mature miRNA. It is subjected to partial 2'-O-methylation and a small amount of phosphorothioate backbone stabilization modifications only at both ends of the sequence, without full-length 2'-O-methylation or cholesterol modification. By specifically binding to mature miRNA, the miRNA inhibitor blocks the complementary base pairing and regulatory effect between miRNA and its downstream target genes, thereby inhibiting the biological functions of miRNA. It is applicable to in vitro cellular-level loss-of-function studies of miRNA.

miRBase ID: MIMAT0000257

Mature miRNA sequence: AACAUUCAUUGCUGUCGGUGGGU

Specifications

Especificaciones y pureza
BioReagent, ≥90%(HPLC)
Estabilidad y almacenamiento
Store at -20℃ long term (12 months). Upon reconstitution, it is recommended to aliquot. Avoid freeze/thaw cycle.
Condiciones de almacenamiento de almacenamiento
Store at -20°C, Avoid repeated freezing and thawing
Enviado en
Ice chest + Ice pads
Este producto requiere envío en cadena de frío. Los servicios terrestres y otros servicios económicos no están disponibles.
Grado
BioReagent
Pureza
≥90%(HPLC)
Nombres e identificadores
Peso molecular 7635.5

Documentation

📋 Safety Data Sheet (SDS)

Comprehensive hazard, handling, storage, and regulatory compliance document.

Download SDS →

✅ Certificate of Analysis (COA)

Lot-specific quality data. Enter your lot number to retrieve the exact COA.

Look up COA →

📊 Datasheet

Quick-reference summary of product specifications and applications.

View datasheet →

🔬 Specification Sheet

Full quality attributes and acceptance criteria for this grade.

View spec sheet →

Advanced Data

Certificados (CoA, COO, BSE/TSE y tabla de análisis)
C of A & Other Certificates(BSE/TSE, COO):
Analytical Chart:

Find and download the COA for your product by matching the lot number on the packaging.

2 results found

Lot NumberCertificate TypeFechaArticulo
ZJ26F0535830Certificate of AnalysisMay 28, 2026 H1487881
ZJ26F0535831Certificate of AnalysisMay 28, 2026 H1487881
Preguntas frecuentes y artículos
Calculadoras de soluciones
Reseñas

Reseñas de cliente

Shall we send you a message when we have discounts available?

Remind me later

Thank you! Please check your email inbox to confirm.

Oops! Notifications are disabled.