GRADE & PURITYBioReagent?BioReagent grade — tested suitable for life-science and molecular-biology use. Use for cell culture, assays, and biochemical work needing biological compatibility.≥90%(HPLC)
Storage
Store at -20°C,Avoid repeated freezing and thawing
BioReagent,≥90%(HPLC) BioReagent for sensitive chromatographic and analytical workflows requiring minimal baseline interference.
🌡
Storage & shipping
Store at -20°C,Avoid repeated freezing and thawing Ships Ice chest + Ice pads Check lot-specific COA for exact specifications.
📋
Quality documents
SDS, COA, datasheet, and spec sheet available for download. Lot-specific COA accessible via lot number lookup.
📚
Literature proof
Cited in 0 peer-reviewed publications across chromatography, organic synthesis, and cross-coupling reactions.
Descripción general
hsa-miR-181b-5p inhibitor is a chemically modified single-stranded oligonucleotide complementary to the sequence of mature miRNA. It is subjected to partial 2'-O-methylation and a small amount of phosphorothioate backbone stabilization modifications only at both ends of the sequence, without full-length 2'-O-methylation or cholesterol modification. By specifically binding to mature miRNA, the miRNA inhibitor blocks the complementary base pairing and regulatory effect between miRNA and its downstream target genes, thereby inhibiting the biological functions of miRNA. It is applicable to in vitro cellular-level loss-of-function studies of miRNA.
miRBase ID: MIMAT0000257
Mature miRNA sequence: AACAUUCAUUGCUGUCGGUGGGU
Specifications
Especificaciones y pureza
BioReagent, ≥90%(HPLC)
Estabilidad y almacenamiento
Store at -20℃ long term (12 months). Upon reconstitution, it is recommended to aliquot. Avoid freeze/thaw cycle.
Condiciones de almacenamiento de almacenamiento
Store at -20°C, Avoid repeated freezing and thawing
Enviado en
Ice chest + Ice pads
Este producto requiere envío en cadena de frío. Los servicios terrestres y otros servicios económicos no están disponibles.
Grado
BioReagent
Pureza
≥90%(HPLC)
Nombres e identificadores
Peso molecular
7635.5
Documentation
📋 Safety Data Sheet (SDS)
Comprehensive hazard, handling, storage, and regulatory compliance document.
We use cookies to ensure the website functions properly and, where permitted, to improve your experience. You can manage your preferences at any time in Settings. Learn more in our Cookie Policy.
Shall we send you a message when we have discounts available?
Remind me later
Thank you! Please check your email inbox to confirm.
Products are supplied to verified businesses, institutions, and qualified professionals for research and development use only. Not for use in humans, animals, diagnosis, or therapy.
ZJ26F0535830
