MicroRNA Mimic Negative Control - BioReagent,≥90%(HPLC) , CAS No.M659388

CAS: M659388 Cat. No.: M659388 Peso molecular: 13332.58
Disponible para pedir
GRADE & PURITY BioReagent ? BioReagent grade — tested suitable for life-science and molecular-biology use. Use for cell culture, assays, and biochemical work needing biological compatibility. ≥90%(HPLC)
Synonyms
miRNA mimic negative control | miRNA mimic NC | Negative control mimic | Scramble mimic | Scrambled miRNA mimic | Non-targeting miRNA mimic | Nonspecific miRNA mimic | Control mimic | miR-NC mimic | miR-scramble | NC mimic
Storage
Store at -20°C,Avoid repeated freezing and thawing
Shipped In
Ice chest + Ice pads
 ·  off list, applied to all prices below.
Size
Estado
Price
Qty
5nmol
M659388-5nmol
1-2 wks(?)
Item is derived from our semi-finished stock and is processed in 1-2 weeks.
59,90US$
20nmol
M659388-20nmol
1-2 wks(?)
Item is derived from our semi-finished stock and is processed in 1-2 weeks.
110,90US$
Enter a quantity for the sizes you want to add.
🧪

Why this grade

BioReagent,≥90%(HPLC) BioReagent for sensitive chromatographic and analytical workflows requiring minimal baseline interference.

🌡

Storage & shipping

Store at -20°C,Avoid repeated freezing and thawing Ships Ice chest + Ice pads Check lot-specific COA for exact specifications.

📋

Quality documents

SDS, COA, datasheet, and spec sheet available for download. Lot-specific COA accessible via lot number lookup.

📚

Literature proof

Cited in 0 peer-reviewed publications across chromatography, organic synthesis, and cross-coupling reactions.

Descripción general

MicroRNA Mimic Negative Control is a 22-nucleotide miRNA mimic and serves as a negative control.

Purification: HPLC

Sense sequence (5'→3'): UUUGUACUACACAAAAGUACUG

Antisense sequence (5'→3'): GUACUUUUGUGUAGUACAAAUU

Specifications

Sinónimos
miRNA mimic negative control | miRNA mimic NC | Negative control mimic | Scramble mimic | Scrambled miRNA mimic | Non-targeting miRNA mimic | Nonspecific miRNA mimic | Control mimic | miR-NC mimic | miR-scramble | NC mimic
Especificaciones y pureza
BioReagent, ≥90%(HPLC)
Estabilidad y almacenamiento
Store at -20℃ long term (12 months). Upon reconstitution, it is recommended to aliquot. Avoid freeze/thaw cycle.
Condiciones de almacenamiento de almacenamiento
Store at -20°C, Avoid repeated freezing and thawing
Enviado en
Ice chest + Ice pads
Este producto requiere envío en cadena de frío. Los servicios terrestres y otros servicios económicos no están disponibles.
Grado
BioReagent
Pureza
≥90%(HPLC)
Nombres e identificadores
Peso molecular 13332.58

Documentation

📋 Safety Data Sheet (SDS)

Comprehensive hazard, handling, storage, and regulatory compliance document.

Download SDS →

✅ Certificate of Analysis (COA)

Lot-specific quality data. Enter your lot number to retrieve the exact COA.

Look up COA →

📊 Datasheet

Quick-reference summary of product specifications and applications.

View datasheet →

🔬 Specification Sheet

Full quality attributes and acceptance criteria for this grade.

View spec sheet →

Advanced Data

Certificados (CoA, COO, BSE/TSE y tabla de análisis)
C of A & Other Certificates(BSE/TSE, COO):
Analytical Chart:

Find and download the COA for your product by matching the lot number on the packaging.

2 results found

Lot NumberCertificate TypeFechaArticulo
ZJ26F0636356Certificate of AnalysisJun 18, 2026 M659388
ZJ26F0636357Certificate of AnalysisJun 18, 2026 M659388
Preguntas frecuentes y artículos
Calculadoras de soluciones
Reseñas

Reseñas de cliente

Shall we send you a message when we have discounts available?

Remind me later

Thank you! Please check your email inbox to confirm.

Oops! Notifications are disabled.