Determine the necessary mass, volume, or concentration for preparing a solution.
for sensitive chromatographic and analytical workflows requiring minimal baseline interference.
Store at -20°C,Avoid repeated freezing and thawing Ships Ice chest + Ice pads Check lot-specific COA for exact specifications.
SDS, COA, datasheet, and spec sheet available for download. Lot-specific COA accessible via lot number lookup.
Cited in 0 peer-reviewed publications across chromatography, organic synthesis, and cross-coupling reactions.
Product content
|
Product Introduction
This kit provides the adaptor and primer used in second-generation sequencing library construction, designed for illumina platform library construction, index primer design can meet the needs of multiple high-throughput sequencing to prepare multiple library samples, the prepared library can be used for Illumina GAIIx, HiSacnSQ, HiSeq 2500/ 2000/1000 and MiSeq sequencing sequencing platform sequencing. 2000/1000 and MiSeq sequencing.
Provide your own instruments, reagents and consumables
1. Magnetic frame: DynaMagTM-2 is recommended.
2. DNA purification recovery kit.
3. DNA building kit.
4. Anhydrous ethanol.
5. Reaction tubes: It is recommended to use low adsorption PCR tubes with 1.5 ml centrifuge tubes;
6. Tip: It is recommended to use a high quality filter tip to prevent contamination of kits and library samples.
Pre-experiment Preparation and Important Notes
1. Adaptor is a double chain structure, do not leave it above room temperature to avoid unraveling and affecting the use.
2. Please centrifuge the Index primer briefly before uncapping so that the liquid collects at the bottom of the tube to avoid cross-contamination between different primers.
Usage process

Operation steps
Please follow the protocol of the second-generation sequencing rapid DNA library building kit for the use of the second-generation sequencing multi sample connector primer kit.
Adaptor for Illumina:
5´-/5Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´
5´-ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´
Universal Primer for Illumina:
5-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T -3´
Index 13–27 Primers for Illumina:
|
Comprehensive hazard, handling, storage, and regulatory compliance document.
Download SDS →Lot-specific quality data. Enter your lot number to retrieve the exact COA.
Look up COA →Full quality attributes and acceptance criteria for this grade.
View spec sheet →