Laboratory Protocols & SOPs Library

Integral adulteration experiments of non-natural amino acids in Escherichia coli

Summary

The doping of amino acid analogs is becoming increasingly useful. The targeted incorporation of non-natural amino acids has made it possible to use chemical biology for the study and application of specific proteins. However, the overall incorporation of non-natural amino acids also tests proteomic and genetic coding assumptions. For example, adaptation of organisms to non-natural amino acids may lead to new gene coding. The source for this experiment is "A Laboratory Guide to Modern Protein Engineering" [German] K.M. Arndt, K.M. Miller, eds.

Operation method

Integral adulteration of unnatural amino acids in Escherichia coli

Materials and Instruments

E. coli strain Tryptophan analogs Oligonucleotide primers
Binding buffer Wash buffer Elution buffer
Luria-Bartani medium Microcon Concentrator

Move

The following methods are included:

( 1 ) Growth of E. coli in a tryptophan analog.

( 2 ) Expression and purification of a protein containing an fW substituted amino acid.

( 3 ) In-depth level analysis of unnatural amino acids.

3.1 Growth of E. coli on unnatural amino acids (medium)

The admixture of tryptophan analogs into E. coli is straightforward. Because tryptophanyl transfer RNA synthetase does not have an edited structural domain, the distinction between natural amino acids and analogs is only structural. The B. subtilis tryptophanyl transfer RNA synthetase can bind (load) fluorescently fluorinated tryptophan analogues relatively more efficiently; 4 fW binds 6-fold less than W, whereas 5fW binds 74-fold less than W [ 13 ]. Similarly, tryptophan analogs have been known to enter cells and support growth for a minimum of several generations before the toxicity of the analogs kicks in. For efficient incorporation of tryptophan analogs, bacterial strains with mutations that prevent biosynthesis are used (see Note 2; references [ 4~6 ], [ 9 ] and [ 11 ]). In the examples presented in this section, E. coli strain C600 and its derivative strains were used. The basic medium is supplemented with threonine, leucine, thiamine, and tryptophan analogs, or certain proportions of unnatural-to-natural amino acids. It is customary to name the media after the supplemented components. For example, M9B1TL 95% 4 fW + Ap is supplemented with vitamin B1 ( thiamine), threonine, leucine, 19:1 4fW : W, and Ap.

The effect of unnatural amino acid incorporation on bacterial growth capacity can be determined by analyzing growth curves. instruments such as the ELX808 Microplate Reader [ 14] or the Bioscreen C [5] can obtain growth curves for multiple microplate formats in parallel. In tests with the Bioscreen C, overnight cultures of C600p in basal medium were diluted 100-fold and inoculated into 1.5 ml of each test medium to test for growth inhibition. These 1.5 ml of medium were divided into 3 pits at 350 μl. Shake constantly at 37°C until all cultures have entered a stable growth phase. Fit the exponential part of the growth curve to the equation:



where f is time, N is the number of organisms (or optical density) at time t, and N0 is the initial number of organisms, the intrinsic growth rate of the bacteria, r, can be calculated. For example, after fitting the exponential portion of the growth curves to Eq. (2.1 ), 4fW caused very little change in the growth rate for ratios below 97% to W, whereas the effect of 5fW and 6fW was much more intense (Fig. 2.1). Therefore, as a routine growth of bacteria, the ratio 19 : 1.4 fW : W can be used in the culture medium. E. coli can be grown for several successive generations if the medium provides only 4 fW of conversation. Furthermore, a more complete understanding of the growth curve can be achieved by fitting the entire curve (as opposed to fitting only the exponential period) to a logarithmic growth equation. This logarithmic growth equation takes into account the carrying capacity:






In the equation, the variables are the same as in equation (2.1 ) except for the carrying capacity K of the culture. This equation has been used to quantify the effect of amino acid analogue incorporation in E. coli under conditions of ammoniacal error [15] .

3.2 Expression and purification of proteins doped with 4fW

This section describes the steps to create two expression plasmids (see 3.2.1.1 and 3.2.1.2 ) and the steps for protein expression and purification under conditions of high substitution rate of W for 4fW (see 3.2.2.1 and 3.2.2.2 ). In the language of expression and purification, the process changes required for growth on amino acid analogs are slightly related to growth on natural amino acids only. Finally, this section will give an overview of methods for isolating total intracellular proteins from bacteria that have been adulterated with non-natural amino acids.

3.2.1 Construction of expression vectors

1 ) pGSR

Since the pUC18 plasmid pGEX-KG [ - a glutathione-S-transferase (GST ) expression vector] in C600p required a selection method other than Ap, the plasmid was degraded with SmaI and EcoRI. p182Sfi-Kan's Kn kinase gene was identified by primers Kan 1.39 ( 5'- CGCGGATCCGGGCCACCATGGCCAAGCGAACCGGAAT) and Kan2.39 ( 5 LCCGGATCCGGCCACCATGGCCAAGCGAACCGGAAT). CGCGGATCCGGCCACCATGGCCAAGCGAACCGGAAT) and Kan2.39 (5 LCCGGAATTCTGAGGCCTGACAGGCCTTAGAAGAACTCGT) were amplified by PCR. The PCR products were degraded with BsaBI and EcoRI and ligated into the pGEX-Kan plasmid degraded with Smal and EcoRI . The PCR product was degraded with BsaBI and EcoRI and ligated onto the Smal- and EcoRI-degraded plasmid pGEX-KG [16], which was then transformed into DH5F' and isolated by micro-preparation (QIAgen). The resulting plasmid pGSR is a GST expression vector with Kn resistance.

2) pET100GFPuv

The gene for highly fluorescent GFPnv was extracted from plasmid pGFPuv with Vent DNA polymerase (NEB) using primers CFPA (5,-CACCACGGCCACTGTGGGCCATGAGTAAAGGAGAAGAACTT-3') and CFPB ( 5 ,- GGCCATCGGGGGCCATGAGTAAAGGAGAAGAACTT-3'). GGCCATCGGGGCCCTATTTTATAGTTCATCCATGCC-3' ) were amplified by PCR; topoisomerase-mediated targeted cloning required the 5'-CACC fragment in the forward primer. Prominent adenosine residues were added to the amplification product by incubating 7.5 μl of the PCR product with 1 μl of 10X buffer, 1 μl of 4 mmol dNTP, and 0.5 μl of Tag DNA polymerase at 72°C for 20 min. This reaction was used to clone the GFPuv gene into pET100/D-topo as directed by the manufacturer. The topoisomerase reaction was used to transform chemically competitive TOP10 cells. The resulting plasmid was isolated by micropreparation (QIAgen). pET100GFPuv is Ap-resistant and under the control of the T7 RNA polymerase promoter, which is required for expression of GFPuv in host strains harboring the λDE3 lysogen.

3.2.2 Protein expression and purification

In order to achieve high levels of incorporation of unnatural amino acids, initial growth is carried out under more permissive conditions and then shifted to more restrictive conditions containing inducers [5] . This aim can also be achieved by providing a limited number of permissive amino acids and an excess of unnatural amino acids. These non-natural amino acids are utilized when the natural amino acids are depleted (see Note 3 and reference [17 ]).

1) Expression and purification of highly doped 4fW GSTs

( 1 ) Overnight growth in M9B1TL 95% 4 fW + Kn of a single plaque of C600p transformed with pGSR and selected on Kn plates.

( 2 ) The initial culture from the first step was diluted 100-fold and inoculated in 100 ml of culture medium of the same substrate. The bacteria were incubated to the mid-exponential phase (mid - log) (optical density 0.5 at 600 nm).

( 3 ) Centrifuge the culture solution at 5400 g for 20 min and suspend in 100 ml of M9B1TL 3 X 100% 4fW + Kn supplemented with 0.3 mmol/L IPTG and continue to incubate for 16 h (see Note 4).

( 4 ) Cells were centrifuged as in step 3 and lysed with 5 ml of B-PER (Novagen) reagent.

( 5 ) After removal of the insoluble fraction by centrifugation, add 10 mmol/L MgCl2 (from a 1 mol stock solution) and 5 U of DNAase and incubate for 15 min at room temperature.

( 6 ) Add 500 μl of 50% glutathione agarose gel pellet to the lysate and mix with a blender for 2 min at room temperature [18] .

( 7 ) Briefly centrifuge the beads at maximum speed. Rinse the pellets with 5 ml of PBS. Repeat rinsing 2 more times.

( 8 ) Make a final rinse with 1 ml of ice-cold PBS and transfer to a microcentrifuge tube.

( 9 ) Add 50 mmol/L Tris-HCl, pH 8.0, plus 5 mmol/L reduced glutathione at room temperature. Spin for 2 min at room temperature to elute purified GST from the spherical beads in 3 fractions of 0.5 ml each.

( 10 ) Concentrate the 3 samples with a M microcon concentrator.

( 11 ) Determine the protein purity by SDS-PAGE; the purity should be higher than 95%.

2 ) Expression and purification of 6fW-adopted GFPuv

( 1 ) Add pET100GFPuv to 200 ml of C600F ( DE3 ) grown in M9B1TL W + Kn + Ap.

( 2 ) At the mid-exponential phase, the culture was centrifuged and the resulting cell pellet was resuspended in 100 ml of M9B1TL 95% 6 fW + Kn + Ap containing 1 mmol/L IPTG for an additional 3 h (see Note 4).

(3) The culture was terminated and the cell pellet was lysed with 3 ml of B-PER. Centrifuge at 15,000 g for 30 min to remove insoluble material. Add 10 mmol/L MgCl2 (from a 1-mol stock solution) and 3 U of DNAase to the supernatant and incubate for 10 min at room temperature.

( 4 ) Prepare a 3 ml Ni-NTA column and rinse with 15 ml water and 9 ml binding buffer.

(5) Pass the supernatant through the Ni-NTA column. Rinse with 30 ml of binding buffer and 18 ml of rinse buffer, and elute with 18 ml of elution buffer. The eluate is collected from the column in 0.5 ml portions and analyzed by SDS-PAGE and by UV irradiation (protein-containing samples are fluorescent). Concentrate protein-containing samples as described in 2.3. 2.2 1 ).

3.2.3 Purification of whole cell protein extracts

For 4fW incorporation:

( 1 ) Grow C600p to saturation in 25 ml of appropriate substrate;

( 2) Centrifuge the culture into droplets and lyse in 200 μl of B-PER;

( 3 ) Pass 50 μl of the lysate through a Centri-Sep size exclusion column to remove unincorporated amino acids.

Similarly, it was used to analyze the identification of 6fW by bacteria:

( 1 ) Saturate growth with C600F in 100 μl of M9B1TL W + Kn medium or M9B1TL 95% 6fW + Kn medium;

(2) Aggregate the bacteria into pellets and lysed in 200 μl B-PER;

( 3) Half the volume of lysate is passed through a Centri-Sep column [see 1) in 2.3.3.1].

3.3 Analysis of the degree of incorporation of unnatural amino acids

Two methods for determining the level of incorporation of non-natural amino acids are discussed in this section. Complete hydrolysis followed by HPLC and mass spectrometry [see 1 in 2.3.3.1], or HPLC analysis followed by HPLC analysis under different conditions [see 2 in 2.3.3.1], can be used for protein purification and whole-cell protein extraction. However, proteolytic digestion and fragmentation (see 2.3.3.2) can only be used for protein purification.

3.3.1 Analysis of Purified Proteins

Examples of the application of the methods described in subsections 2.3.3.1 (1) and 2.3.3.1 (2) are shown in Table 2.1.



1 ) Hydrolysis and HPLC-ESI analysis of proteins containing unnatural amino acids

Acid hydrolysis of protein samples can determine the composition of the protein. Whether it is a whole cell protein extract or a purified protein, it is subjected to overall averaging.

( 1 ) Lyophilized protein samples (e.g., a half-volume eluate from a Centri-Sep column in 2.3.2.3, a few milligrams of purified protein in 2.3. 2.2).

( 2 ) Resuspend group material in 1 ml of 5.4 mol/L hydrogen chloride containing 10% mercaptoacetic acid to protect tryptophan in hydrolysis.

( 3 ) Hydrolyze under vacuum and at 110°C overnight.

( 4 ) Lyophilize the hydrolysis product and resuspend in 50 μl of water.

The hydrolyzed product can be analyzed by HPLC-ESI. In this case, the specific mass of natural and unnatural amino acids can be determined and tracked as they elute from the HPLC column. The relative ratio of the eluted masses can be determined from the area under the curve. The actual number of moles of amino acids can be determined from the standard curve.

2 ) HPLC-HPLC Analysis of Hydrolyzed Protein Samples

Another approach is to complete a series of HPLC analyses.

( 1 ) The hydrolysis reagent is injected onto a C-18 column and eluted using the following procedure.

a. Elute with 94% Buffer A and 6% Buffer B for 20 min.

b. Switch to 98% Buffer A and 2% Buffer B using a gradient method within 10 min.

c. Elute again for 15 min.

d. Re-equilibrate the column to 94% Buffer A and 6% Buffer B for the last 5 min.

( 2 ) Collect the eluate corresponding to the standard peaks (e.g., W and 6fW) and lyophilize, then resuspend in water.

( 3 ) Reinject the sample into the same column, but change the buffers to 80% Buffer C and 20% Buffer D. Simultaneous elution of different molecules may occur under one set of buffer conditions, but is unlikely to occur under two sets of buffer conditions. The area under the curve under the second buffer condition can be considered a pure sample and can be compared to peak areas corresponding to natural and unnatural.

In the presence of tryptophan and tryptophan analogs, detection at 280 nm does not require derivatization (see Note 5). Phenylalanine and tyrosine show small absorption peaks in purified proteins, whereas extracts of whole-cell proteins produce a large number of small peaks. Nevertheless, quantitative data are available.

3.3.2 Protease degradation to determine the level of unnatural amino acid incorporation

Since the mass of a specific polypeptide fragment can be predicted based on the protein sequence, it is possible that the predicted mass shift in the fragment is due to specific unnatural amino acid adulteration. Thus, analyzing protease degradation products is a sensitive method for determining amino acid analog adulteration [ 5, 19, 20].

( 1 ) Lyophilized purified GST [ e.g., 5 μg, see 1 ) in 2.3.2.2 ] and resuspended in 0.1 mol/L ammonium bicarbonate.

( 2 ) Degradation with immobilized L-toluenesulfonamide-2-phenylethyl chloromethyl ketone-treated trypsin (Pierce) at 37°C for 10 h. The trypsin should be degraded at 37°C for 10 min.

( 3 ) Centrifuge to remove trypsin (see Note 6).

( 4 ) The degradates are lyophilized and resuspended to 210 μmol/L in water.

( 5 ) Analyze the degradation products by HPLC-ESI.

Elution profiles of specific masses can be followed and the level of incorporation of unnatural amino acids in specific fragments can be demonstrated (Fig. 2.2 ).




For more product details, please visit Aladdin Scientific website.

https://www.aladdinsci.com/

Categories: Laboratory Protocols & SOPs Library
Explore topics: protein experiment

Da — when not otherwise indicated, molecular weight units are daltons.   Mw — weight-average molecular weight.   Mn — number-average molecular weight.

Products are supplied for research and development use only. Not for use in humans, animals, diagnosis, or therapy.

Cite this article

Aladdin Scientific. "Integral adulteration experiments of non-natural amino acids in Escherichia coli" Aladdin Knowledge Base, updated Jun 9, 2025. https://www.aladdinsci.com/us_en/faqs/integral-adulteration-experiments-of-non-en.html
Was this article helpful? Yes No 2 out 5 found this helpful

Shall we send you a message when we have discounts available?

Remind me later

Thank you! Please check your email inbox to confirm.

Oops! Notifications are disabled.