GRADE & PURITYBioReagent?BioReagent grade — tested suitable for life-science and molecular-biology use. Use for cell culture, assays, and biochemical work needing biological compatibility.≥90%(HPLC)
Storage
Store at -20°C,Avoid repeated freezing and thawing
BioReagent,≥90%(HPLC) BioReagent for sensitive chromatographic and analytical workflows requiring minimal baseline interference.
🌡
Storage & shipping
Store at -20°C,Avoid repeated freezing and thawing Ships Ice chest + Ice pads Check lot-specific COA for exact specifications.
📋
Quality documents
SDS, COA, datasheet, and spec sheet available for download. Lot-specific COA accessible via lot number lookup.
📚
Literature proof
Cited in 0 peer-reviewed publications across chromatography, organic synthesis, and cross-coupling reactions.
Overview
hsa-miR-181b-5p antagomir is a chemically modified single-stranded oligonucleotide complementary to the mature miRNA. It is fully 2'-O-methylated over the entire sequence, with 2 phosphorothioate modifications at the 5' end and 4 phosphorothioate modifications at the 3' end, and is conjugated with high‑affinity cholesterol‑TEG at the 3' terminus. The miRNA antagomirs strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Stability of miRNA antagomirs appears to be significantly higher than miRNA inhibitors, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.
miRBase ID: MIMAT0000257
Mature miRNA sequence: AACAUUCAUUGCUGUCGGUGGGU
Specifications
Specifications & Purity
BioReagent, ≥90%(HPLC)
Stability And Storage
Store at -20℃ long term (12 months). Upon reconstitution, it is recommended to aliquot. Avoid freeze/thaw cycle.
Storage
Store at -20°C, Avoid repeated freezing and thawing
Shipped In
Ice chest + Ice pads
This product requires cold chain shipping. Ground and other economy services are not available.
Grade
BioReagent
Purity
≥90%(HPLC)
Names and Identifiers
Molecular Weight
8487.47
Documentation
📋 Safety Data Sheet (SDS)
Comprehensive hazard, handling, storage, and regulatory compliance document.
We use cookies to ensure the website functions properly and, where permitted, to improve your experience. You can manage your preferences at any time in Settings. Learn more in our Cookie Policy.
Shall we send you a message when we have discounts available?
Remind me later
Thank you! Please check your email inbox to confirm.
Products are supplied to verified businesses, institutions, and qualified professionals for research and development use only. Not for use in humans, animals, diagnosis, or therapy.