Protocols

miRNA cloning assay

Summary

In addition to the familiar mRNA, there are also a large number of non-coding RNA (ncRNA) that do not code for proteins. Non-coding RNA plays a very important role in the cell, such as rRNA and tRNA to maintain the expression of genes, and some of them play a role in regulating the expression of genes. This experiment is from "RNA Laboratory Guidebook", edited by Xiaofei Zheng.

Operation method

miRNA cloning experiment

Principle

In addition to the familiar mRNA, there are a large number of noncoding RNAs (ncRNAs) that do not code for proteins. Noncoding RNAs play very important roles in cells, such as rRNAs and tRNAs, which maintain gene expression, and some of them play a role in regulating gene expression.

Materials and Instruments

Oligonucleotides Acetonitrile ImpA p17.91X DEPC Glycogen T4 RNA Ligase Reverse Transcriptase dNTP DTT EDTA T4 DNA Ligase BanⅠ Restriction Endonuclease Taq Enzyme M13F Primer M13R Primer
Mixing solution Precipitation solution Sampling solution Ethanol T4 RNA ligase buffer Redistilled water KOH Tris-HCl T4 RNA ligase buffer NEB buffer Solvent solution
TOPO TA Cloning Kit

Move

I. Materials and equipment

1. Oligonucleotides.

2. acetonitrile.

3. mixture A: 0.5 mmol AMP (5' phosphorylated) dissolved in 15 ml of dimethyl formamide.

4. Mixture B: 1 mmol triphenylphosphine, 1 mmol 2,2'-bipyridine disulfide, 2.5 mmol imidazole, 0.90 ml triethylamine dissolved in 15 ml of dimethyl formamide.

5. Precipitation solution: 9 mmol NaClO4, 225 ml acetone, 115 ml ether (anhydrous ether).

6. 25 mmol MgCl2.

7. 50 mmol/L ImpA ( ImpA synthesis is described in section 2 of the operating method).

8. 0.2 mmol/L p17.91X ( see Methods section 1 for 3' end-closed 3' end donor oligonucleotide).

9. Sampling solution: 8 mol/L urea, 0.5 mmol/L EDTA.

10. ethanol.

11. DEPC.

12. Glycogen.

13. 5X T4 RNA ligase buffer: 250 mmol/L Hepes ( pH 8.3), 50 mmol/L MgCl2, 16.5 mmnol/L DTT, 30 μg/ml BSA, 41.5% glycerol.

14. t4 RNA ligase.

15. reverse transcriptase (invitrogen superscript RT).

16. redistilled water.

17. 10X dNTP (1X dNTP containing 0.2 mmol/L of each dNTP).

18. 100 mmol/L DTT.

19. 0.1 mol/L EDTA.

20. 1 mol/L KOH.

21. 1 mol/L Tris-HCl ( pH 1.0 ).

22. 0.2 mol/L MgCl2.

23. T4 DNA ligase.

24. 5X T4 RNA ligase buffer: 250 mmol/L Tris-HCl (pH 7.5), 50 mmol/L MgCl2, 50 mmol/L DTT, 5 mmol/L ATP, 125 μg/ml BSA.

25. ban Ⅰ restriction endonuclease.

26. 10X NEB buffer 4: 500 mmol/L potassium acetate, 200 mmol/L Tris-HAc, 100 mmol/L magnesium acetate, 10 mmoI/L DTT.

27. lysate solution: 20 mmol/L Tris-HCl pH 8.0, 0.1 mmol/L EDTA pH 8.0.

28. TOPO TA cloning kit.

29. Taq enzyme.

30. M13F Primer: 5' GGTAACGCCAGGGTTTTCC 3'.

31. M13R Primer: 5' CAGGAAACAGCTATGACC 3'.

32. 1X Sampling solution: 8 mol/L urea, 0.5 mol/L EDTA.

II.

1. Oligonucleotide design

(1) Oligonucleotides for RNA cloning (the underlined part is BanⅠ cleavage site G↓GYRCC):

3' end donor oligonucleotide: 17, 91-pCTGTAGGCACCTCAAx (x: DMT-O-C3-CPG).

5' end acceptor oligonucleotide: 17.93R ATCGTaggcacctgaaa (lowercase portion is RNA, uppercase portion is DNA).

3' end reverse transcription primer: 15.22-ATTGATGGGTGCCTAC.

5' end PCR primer: 17.93D-ATCGTAGGCACCTGAAA.

3' end PCR primer: 17.92-ATTGATGGTGCCTACAG.

(2) 18 and 24 base RNA Marker transcript sequences:

The T7 promoter transcribes a 24-base sequence (T7 promoter in italics).

44.12D: TCACTATTGTTGAGAACGTTGGCCTATAGTGAGTCGTATTACGC, RNA Marker transcribed from 44.12D (with AclⅠ cleavage site).

44.12R: GGCCAACGUUCUCAACAACAAUAGUGA.

RNA Marker purchased from Dharmacon (contains BamHⅠ cleavage site).

18.113: AGCGUGUAGGGAUCCAAA.

2. Synthesis of ImpA

(1) Synthesis. The materials for the synthesis of ImpA can be purchased from Sigma, and the purity is required to be at least 99%. Mixture A and mixture B are contained in an anhydrous beaker, and A is slowly mixed with B by stirring. At first, the two mixtures are immiscible, but when the color of the reaction changes to a yellowish-green color, the solids begin to dissolve, and the oil that appears at the bottom of the beaker will eventually dissolve as well. Stir for 1~1.5 h at room temperature.

(2) Purification. Add the precipitate drop by drop, ImpA begins to precipitate out, leaving 60 ml of liquid for analysis. Transfer the precipitate to a centrifuge tube, wash the remaining precipitate with acetone, centrifuge at 5000 r/min for 10 min, pour out the acetone, and wash with acetone for two times. Finally, the sample is washed with ether, centrifuged at 3000 g for 20 min, dried under vacuum overnight between 22.5 and 45°C, and stored in vials at -20°C. The sample is then stored at -20°C.

(3) Analysis. Weigh the synthesizer. Pre-soak the cellulose with 10 times the volume of saturated ( NH4)2SO4 and then dry for cellulose thin-layer chromatography. Dissolve AMP and ImPA in water. Spot sample Mixture A, ImpA, Mixture B, the retention liquid from the purification step, and the water-dissolved AMP, respectively. Expanded 9 cm with 80% ethanol, AMP was the slowest, followed by ImpA, with Mixture B and the residue at the top. Observation was made with a portable UV lamp.

3. Oligonucleotide synthesis

All primers were synthesized using a Biosystems 8900 DNA synthesizer.

4. Preparation of radiolabeled RNA marker

RNA marker 44.12R was obtained by in vitro transcription of 44.12D. RNA markers 18.113 and 44.12R were labeled with 32P, and then purified by electrophoresis on 20% denaturing polyacrylamide gels, and recovered to obtain the radiolabeled 18- and 24-base RNA markers (see the relevant sections for the procedure).

5. Adenylylation of oligonucleotides Synthesis of 1x

500 μl reaction system containing 25 mmol MgCl2, 50 mmol/L ImpA, 0.2 mmol/L 17.91x. Incubate at 50°C for 3 h. Purify by electrophoresis on a 20% denaturing polyacrylamide gel with a gel thickness of 1.5 mm and a sampling well 23 mm wide. The gel was electrophoresed, cut, soaked in 0.3 mol/L NaCl overnight, precipitated with 2x volume of ethanol at -20 °C for at least one hour, centrifuged at 12,000 g for 20 min, the supernatant was discarded, the precipitate was allowed to dry, and the precipitate was dissolved in distilled water. The final product, App 17.91x, can be stored at -80°C for several months.

6. Micro RNA purification

15% denatured polyacrylamide gel, the sample wells are 23 mm wide, first pre-electrophoresis, then mix the extracted total RNA with trace amounts of highly sensitive radiolabeled RNA markers (radiolabeled 18.113 and 44.12R) and 1 times the volume of the sample solution, heat at 80°C for 5 min, apply the sample, and then electrophoresis until the indicator dye reaches the bottom of the electrophoresis bath, remove the gel, radioautography, and then electrophoresis. The gel was removed, radiographically autoradiographed, and the portion between the radiolabeled substances was cut off from the gel, soaked in 0.3 mol/L NaCl overnight, then precipitated with 2 times the volume of ethanol, centrifuged, and resuspended in 10~20 μl of DEPC-treated water.

7. Connection of the 3' end of the microRNA junction

The 3' end-joining reaction system was as follows: 2 μl of 5X RNA ligation buffer, 2 μl of 200 μmol/L App 17.91x, 1 μl of T4 RNA ligase, 5 μl of microRNA, isotope-labeled RNA marker, total volume of 10 μl.

The reaction was terminated with 10 μl of 2X sample solution after 2~6 h at room temperature. The reaction was terminated with 10 μl of 2X sample solution after 2-6 h at room temperature. 10% denaturing polyacrylamide gel electrophoresis was performed, and the portion of the gel between 35-43 bases was cut off by radiolabeled Marker, immersed in 0.3 mol/L NaCl overnight, then precipitated with 2 times the volume of ethanol, and finally dissolved in 10-20 μl of DEPC-treated water.

8. Connection of the 5' end of the microRNA junction

The 5' end-joining reaction system was as follows: 2 μl of 5X RNA ligation buffer, 2 μl of 200 μmol/L App 17.93R, 1 μl of 4 mmol/L ATP, 1 μl of T4 RNA ligase, 5 μl of 3' end-joining product of microRNA, total volume 10 μl.

The reaction was terminated with 10 μl of 2X sample solution after 2~6 h at room temperature. Use the same method as the 3' end purification to obtain a mixture of 52-60 bases, and resuspend in 10-20 μl of DEPC-treated water for storage.

9. RT-PCR of ligated microRNAs

The reaction system was as follows: RNA ligation product 5 μl, 100 μmol/L 15.22 3 μl, dH2O 5 μl.

After mixing, heat at 30°C for 2 min, and then continue to add:

5X reverse transcription buffer 5 μl, 10X dNTP 7 μl, 100 mmol/L DTT 3 μl, Superscript Ⅱ reverse transcriptase 3 μl.

Before adding the reverse transcriptase, preheat at 48 ℃ for 3 min, and take out 2 μl from the total volume as control. After all the reagents were added, the reaction was incubated at 48 ℃ for 1 h. Then 1 μl of 0.1 mol/L EDTA and 3.8 μl of 1 mol/L KOH were added and heated at 90 ℃ for 10 min to remove all the RNA, and then the reaction was neutralized with 4 μl of 1 mol/L TriS-HCl pH 1.0 and 1 μl of 0.2 mol/L MgCl2 . All RT reaction products were used for PCR amplification.

The PCR reaction system was as follows: 5 μl of reverse transcription product, 10 μl of 10X PCR buffer, 10 μl of 10X dNTP, 1 μl of 100 μmol/L 17.92, 1 μl of 100 μmol/L 17.93D, 2 μl of Taq enzyme, and 71 μl of dH2O in a total volume of 100 μl.

Amplify for 20~25 cycles at 94°C for 1 min, 50°C for 1 min and 72°C for 1 min.

The amplification was detected by 15% denaturing polyacrylamide gel electrophoresis and stained with SYBR Gold (purchased from Molecular Dynamics). The aqueous phase was extracted with phenol for 2 times and then with chloroform for 2 times, then NaCl was added to 0.3 mol/L, and the PCR amplification products were precipitated with ethanol and finally dissolved into 40 μl of water.

10. Ligation of PCR products

The PCR products were digested with Ban I. The enzymes and buffers were purchased from New England BioTech. The reaction system was as follows: 40 μl of PCR product, 30 μl of NE buffer 4, 10 μl of BanⅠ20 U/μl, 220 μl of dH2O, for a total volume of 300 μl.

The reaction was carried out at 37 °C for 4 h. 15 μl was analyzed by electrophoresis on a 15% denaturing polyacrylamide gel, and 1 μl of the PCR product and a 10 bp DNA ladder were used as standard controls. The product was stained with SYBR Gold. The product was extracted twice with phenol and twice with chloroform, and NaCl was added to 0.3 mol/L. The Ban I-digested PCR product was precipitated with ethanol. The following reagents were added to the precipitate for the ligation reaction: 8 μl of H2O, 1 μl of 10X T4 DNA ligase buffer and 1 μl of T4 DNA ligase.

The reaction was carried out at room temperature for 30 min. agarose electrophoresis was carried out with 100 bp DNA Marker as standard. Cut off the fragments larger than 300 bp from the gel, add 10 times the volume of lysate, and place at 65°C for 5 min. Divide the melted gel into several centrifuge tubes, add an equal volume of phenol, shaking for 20 s, and then centrifuge at 5000 g for 10 min at 4°C. Remove the aqueous phase, and then extract it with a mixture of phenol: chloroform (1:1). Add 0.06 times the volume of 5 mol/L NaCl and 2.5 times the volume of ethanol, and precipitate for more than 2 h at -20 ℃.

11. Ligation of PCR ligation product to TOPO vector

Dissolve the precipitate from the previous step in the following system: 11.5 μl of H2O, 1.5 μl of 10X PCR buffer, 1.5 μl of 10X dNTP, and 0.5 μl of Taq enzyme.

React for 5 min at 72°C. Take 5 μl for ligation with TOPO vector. All ligated products were used for transformation. Add 500 μl of SOC medium to the transformed sensory bacteria, incubate at 37℃ for 45 min, and then apply 75 μl, 150 μl and 300 μl of to the aminopyralid-resistant plate, and grow at 37℃ overnight.

12. Screening and sequencing

Pick the white clones, plate, grow overnight, and screen by PCR, the PCR reaction system is as follows: 10X PCR buffer 3 μl, 10X dNTP 3 μl, 100 μmol/L M13F 0.2 μl, 100 μmol/L M13R 0.2 μl, Taq enzyme 0.5 μl, dH2O 23 μl, the total volume of 30 μl.

The reaction was performed at 94°C for 3 min, 94°C for 40 s, 50°C for 40 s, and 72°C for 40 s for 25 cycles. Agarose gel electrophoresis was detected, and clones containing insertion sequences of about 500-800 bp were selected for sequencing. The sequences were analyzed using bioinformatics methods.


For more product details, please visit Aladdin Scientific website.

https://www.aladdinsci.com/

Categories: Protocols
Explore topics: RNA Lab

Da — when not otherwise indicated, molecular weight units are daltons.   Mw — weight-average molecular weight.   Mn — number-average molecular weight.

Products are supplied for research and development use only. Not for use in humans, animals, diagnosis, or therapy.

Cite this article

Aladdin Scientific. "miRNA cloning assay" Aladdin Knowledge Base, updated Dec 24, 2024. https://www.aladdinsci.com/us_en/faqs/mirna-cloning-assay-en.html
Was this article helpful? Yes No 1 out 1 found this helpful

Shall we send you a message when we have discounts available?

Remind me later

Thank you! Please check your email inbox to confirm.

Oops! Notifications are disabled.