Protocols

M13 Experiments on the application of phage coat protein modification in improved phage display technology

Summary

This chapter describes a method for improving the level of fusion protein presentation on the surface of M13 phage particles. Introduction of a mutation to the M13 coat-anchored protein increases the level of protein presentation by approximately two orders of magnitude. This experiment is derived from "A Guide to Modern Protein Engineering Experiments" [German] K.M. Arndt, K.M. Miller, eds.

Operation method

M13 Application of phage coat protein modification in improved phage display technology

Materials and Instruments

Carbenicillin Chloramphenicol E. coli CJ236
Physiological phosphate buffer Ultrapure glycerol PBS-T buffer PBS-T-BSA buffer
2YT medium SOC medium

Move

The following methodology describes the design (see 12.3.1), construction (see 12.3.2), selection (see 12.3.3.1), and screening (see 12.3.3.2) of P8 libraries for the identification of mutants capable of improving protein expression levels. We describe a protocol for improving hGH expression levels using the aforementioned phage, pS1607. This approach is also applicable to any other target protein. The only changes are the replacement of pS1607 with a phage particle expressing the target protein and the replacement of pS1607 with the high affinity
ligand for the target protein and the replacement of the hGH-binding protein with a high-affinity ligand for the target protein.

3.1 Library design

We have previously mentioned that the N-terminal portion of P8 is extremely resistant to mutations in phage expression systems, some of which increase the level of display of heterologous fusion proteins [ 10, 11]. Subsequently, we found that only six wild-type residue side chains (Ala 7, Ala 9, Ala 10, Phe11, Leu14, and Ala18 ) at the N-terminus of P8 are required for the efficient packaging of P8 into the phage shell [ 10, 12]. These side chains form a tightly packed hydrophobic antigenic determinant cluster (Figure 12.1) that plays a key role in phage assembly. Mutations in residues surrounding this determinant cluster increase the packaging efficiency and thus the heterologous protein
level of display [ 10 ]. Based on these studies, we identified seven sites (Pro 6, Lys 8, Asn12, Ser13, Gln15, Ala16, and Ser17) where mutations are most likely to improve the level of protein presentation (Figure 12.1). Complete randomization of the seven sites within the protein can result in close to 109 unique amino acid combinations, a diversity that can be covered by the ~1010 diversity of the preparative libraries described here.



3.2 Library construction

The P8 mutant library was constructed using an optimized version of the oligonucleotide-induced mutagenesis method described previously [2]. First, a mutated oligonucleotide (sequence: GTAATAATAAGCGACCGAATATATATC) was used to introduce a stop codon at the randomization site; the oligonucleotide-induced site-specific mutagenesis scheme provided in Section 12.3.2.2 can be used for small-scale mutations to introduce stop codons (see Note 1 ). The introduction of the termination codon eliminates the expression of the wild-type protein, so the "termination template" phage can be used as a template for library construction. Uracil-containing single-stranded DNA termination templates (purified from the host) and mutant oligonucleotides (sequence: GCCGAGGGGTGACGATNNKGCATAAGCGGGCCTTTNNKNKCTGNNNKNKNKNKGCGACCGAATATATATC ) were annealed so that they were used with the NNK encoding the 20 amino acids ( N = A/G/ C/T, 25% each; K = G/T, 50% each )
termination codons were replaced. The mutant oligonucleotide strand is used as a primer to synthesize a complementary DNA strand, resulting in a covalent closed-loop double-stranded heterogeneous DNA (CCC-dsDNA). After library construction, the CCC-dsDNA is introduced into the host by electrotransformation, where the mismatch is repaired according to the wild or mutated sequence. In ung+ strains, the dU template strand tends to be inactivated while the synthesized mutant strand is proliferated so that effective mutation is achieved (big
than 50% ). Templating with sequences whose randomization sites are all stop codons ensures that only fully mutated clones contain readable frames that can be displayed on the phage surface. Transformation of the host E. coli with helper phages allows the various members of the library to be packaged into phage particles.

3.2.1 Purification of dU-ssDNA template

Mutagenesis efficiency depends on the purity of the template, so the application of high purity dU-ssDNA is crucial for successful library construction. We used the Qiagen QIAprep Spin M13 Kit to purify dU-ssDNA, and the following is a modified version of the Qiagen protocol. For a medium-copy phage (e.g. PS1607, which contains the backbone of pBR322), this protocol yields at least 20 μg of dU-ssDNA, which is sufficient for library construction (see Note 2).

( 1 ) Pick a single clone of E.coli CJ236 ( or other dut- / ung- ) strain containing a particular phage from a fresh LB/antimicrobial plate into 1 ml of 2YT plus M13KO7 helper phage ( 1010 pfu/ml) and corresponding antimicrobials in medium to maintain the host F' add-on and phage. For example, 2YT/Carb/cmp medium contains benzylpenicillin carboxylate to select for phage with the lactamase gene, and chloramphenicol to select for CJ236
Shake at 37°C and 200 r/min for 2 h and add kanamycin (25 μg/ml) to select clones co-transfected with M13KO7 with kanamycin resistance gene. After shaking at 37°C and 200 r/min for 6 h, the culture was transferred to 30 ml of 2YT/carb/kan/uridine medium. Shake at 37°C and 200 r/min overnight.

( 2 ) Centrifuge at 27000 g (15000 r/min in Sorvall SS-34 rotor) at 4°C for 10 min. transfer the supernatant to a new tube containing 1/5 volume of PEG/NaCl and incubate at room temperature for 5 min. centrifuge at 12000 g (10000 r/min in Sorvall SS-34 rotor) at 4°C for 10 min. transfer the supernatant. Pipette the supernatant, centrifuge briefly at 2000 g (4000 r/min) and aspirate the residual supernatant.

( 3 ) Resuspend the phage pellet in 0.5 ml of PBS and transfer to a new EP tube. Centrifuge at 14,000 g for 5 min in a tabletop microcentrifuge and transfer the supernatant to a new EP tube.

( 4 ) Add 7.0 μl MP Buffer (Qiagen) and mix well. Incubate at room temperature for at least 2 min.

( 5 ) Add the above sample to a QIAprep spin column (Centrifugal Chromatography Column, Qiagen) in a 2 ml small centrifuge tube. Centrifuge in a tabletop microcentrifuge at 6000 g for 30 s. Discard the effluent. The phage pellet remains bound in the column medium.

( 6 ) Add 0.7 ml of MLB buffer (Qiagen) to the column. centrifuge at 6000 g for 30 s and discard the effluent.

( 7 ) Add 0.7 ml of MLB buffer to the column. Incubate at room temperature for at least 1 min. centrifuge at 6000 g for 30 s. Discard the effluent. The phage DNA is separated from the chitin and remains adsorbed in the column medium.

( 8 ) Add 0.7 ml of PE buffer (Qiagen). centrifuge at 6000 g for 30 s. Discard effluent.

( 9 ) Repeat step (8) to remove residual protein and salt.

( 10 ) Centrifuge at 6000 g for 30 s. Transfer the mini-column to a new 1.5 ml EP centrifuge tube.

( 11 ) Add 100 μl of EB buffer (Qiagen: 10 mmol/L Tris-HCl, pH 8.5) to the center of the column membrane. Incubate at room temperature for 10 min, then centrifuge at 6000 g for 30 s. Save the effluent, which contains the purified dU-ssDNA.

( 12 ) Analyze the above DNA by TAE agarose gel electrophoresis with 1.0 μl of DNA solution. The resultant DNA should be a clear single band, but some weak bands with low electrophoretic mobility are often observed (see lane 2 in Fig. 12.2 ). These weak bands are most likely due to the secondary structure of the ssDNA.

( 13 ) Determine the DNA concentration using the absorption value at 260 nm ( A260 = 1.0 corresponds to 33 ng/μl single-stranded DNA). Typical DNA concentrations should range from 200 to 500 ng/μl.

3.2.2 In vitro Synthesis of Heterologous Double-stranded CCC-dsDNA

Mutant oligonucleotides can be packaged into heterologous CCC-dsDNA in a three-step procedure using dU-ssDNA as a template. The protocol described here is an improved and scaled-up version of the previous method [13] . The oligonucleotides are first 5' phosphorylated and then annealed to a dU-ssDNA template. The oligonucleotide strands are extended and ligated to form heterologous CCC-dsDNA (lane 3 in Figure 12.2), which is then purified and desalted. This protocol yields approximately 20 μg of high-purity, low-conductivity CCC-dsDNA, which is sufficient to construct libraries with a capacity of more than 1010 (see Note 3).



1 ) Phosphorylation of oligonucleotides with T4 polyribonucleotide kinase

( 1 ) Mix 0.6 μg of mutant oligonucleotide, 2.0 μl of 10X TM Buffer, 2.0 μl of 10 mmol/L ATP, and 1.0 μl of 100 mmol/L DTT in a 1.5 ml EP tube. add water to a total volume of 20 μl.

( 2 ) Add 20 U of T4 polynucleotide kinase to the above system and incubate at 37°C for 1 h (see Note 4).

2 ) Anneal the oligonucleotides together with the template.

( 1 ) Add 20 μg of dU-ssDNA template (from 12.3.2.1), 25 μl of 10 X TM buffer, and water to a total volume of 250 μl to 20 μl of phosphorylation reaction mixture. assuming an oligonucleotide-to-template length ratio of 1:100, the above amount of DNA gives a 3:1 oligonucleotide-to-template molar ratio.

( 2 ) Incubate at 90°C for 3 min, 50°C for 3 min, and 20°C for 5 min (see Note 5).

3 ) Synthesize CCC-dsDNA

( 1 ) Add 10 μl of 10 mmol/L ATP, 10 μl of 25 mmol/L dNTP, 15 μl of 100 mmol/L DTT, 30 Weiss U of T4 DNA ligase, and 30 U of T7 DNA polymerase to the annealed oligonucleotide-template mixture.

( 2 ) Incubate at 20°C overnight.

( 3 ) Affinity purification and desalting of the above DNA using Qiagen QIAquick DNA Purification Kit. Add 1.0 ml of QG (Qiagen) buffer to the mix.

( 4 ) Place the above samples onto two QIAquick spin columns in 2 ml centrifuge tubes. Centrifuge at 14,000 g for 1 min in a small tabletop centrifuge to remove the flow-through liquid.

( 5 ) Add 750 μl of PE buffer (Qiagen) to each column. centrifuge at 14,000 g for 1 min to remove flow-through, then centrifuge at 13,000 r/min for 1 min. Place the columns in new 1.5 ml EP microcentrifuge tubes.

( 6 ) Add 35 μl of USP ultrapure water to the center of the column membrane. Incubate for 2 min at room temperature (see Note 6).

(7) Centrifuge at 14,000 g for 1 min to elute the DNA. mix the eluent from both tubes. The resulting DNA can be used immediately for E. coli electrotransformation or frozen for later use.

( 8 ) Simultaneously electrophoreze 1.0 μl of the above eluted reaction product with the dU-ssDNA template. The DNA is detected by electrophoresis on a TAE agarose gel containing ethidium bromide (EB) (Fig. 12.2 and Note 7).

A successful reaction results in the complete conversion of dU-ssDNA to dsDNA with low electrophoretic mobility. usually, at least two product bands are seen and no dU-ssDNA is present (Figure 12.2). The band with the higher electrophoretic mobility is the desired product - a correctly extended and ligated CCC-dsDNA that can be used to efficiently transform E. coli and provides a high mutation efficiency (~80%). The lower mobility bands are single-stranded aberrations caused by the asterisk activity of T7 DNA polymerase [14], which have a lower mutation rate (~20%) and can be transformed with only 1/30th of the efficiency of CCC-dsDNA. if a significant portion of the ssDNA template is transformed into CCC-dsDNA, a highly mutable and diverse library can be obtained. A third band with an electrical mobility between the two is sometimes obtained, which is correctly stretched but has no ligated dsDNA (Fig. 12.2). This band is either due to insufficient T4 DNA ligase activity or incomplete oligonucleotide phosphorylation.

3.2.3 E. coli electroporation and phage amplification

To complete the library construction, the heterologous CCC-dsDNA must also be introduced into an E. coli host containing the F' add-on.The M13 phage is able to infest and proliferate in such a host. The diversity of phage display libraries is also limited by the method of DNA introduction into E. coli, with high-voltage electroconversion being the most efficient.

We constructed an E. coli strain, SS320, which is ideal for efficient electroconversion and phage proliferation [2]. Using a standard phage hybridization protocol [ 15], we transferred the F' add-on from E.coli XL-1 Blue (Stmtagene) to E.coli MC1061 (Bio-Rad). the chromosome of E.coli MC1061 is labeled with streptomycin resistance, whereas the add-on of E.coli XL-1 Blue contains tetracycline resistance, so that the hybridization E. coli SS320 retains the high electrotransformation efficiency of E.coli MC1061 , while the presence of the F' add-on makes it possible for the M13 phage to infect the host.

( 1 ) Cool the purified DNA ( from 3 ), approximately 20 μg in a minimum volume) and 0.2 cm gap electrotransformation bath on ice. Melt 350 μl of fractionated electroreceptor E.coli SS320 cells on ice. Add the receptor cells to the DNA and mix by pipetting several times (to avoid bubbles).

( 2 ) Transfer the mixture to the electroporation tank for electroporation transformation. For electroporation, follow the manufacturer's instruction manual. It is recommended to use the BTX ECM-600 Electro-Converter with the following settings: field strength 2.5 kV, resistance 129 Ω, capacitance 50 μF. You can also use BioRad's Gene Pulser Electro-Converter with the following settings: field strength 2.5 kV, resistance 200 Ω, capacitance 25 μF.

( 3 ) Immediately add 1 ml of SOC medium to the electrotransformation tank after electroporation to rescue the cells and transfer the medium to a 250 ml conical flask. Rinse the flask twice with 1 ml of SOC medium. Add SOC medium to the flask to a final volume of 25 ml and incubate for 20 min at 37°C on a 200 r/min shaker.

( 4 ) To determine the diversity of the constructed library, the appropriate phage (e.g., pS1607 with the β-lactamase gene) can be selected by serial dilution of plates in LB/carb dishes.

( 5 ) Add M13KO7 helper phage (4 X 1010 pfu/ml) and incubate for 10 min at 37°C on a shaker at 200 r/min.

( 6 ) Transfer the culture to a 2 L conical flask containing 500 ml of 2YT medium and add appropriate antibiotics for phage selection (e.g. 2YT/carb medium).

( 7 ) Incubate at 200 r/min for 1 h at 37°C and add 25 μg/ml of kanamycin. Then incubate overnight at 37°C with shaking at 200 r/min.

( 8 ) Centrifuge the above culture solution at 4°C and 16000 g (10000 r/min in Sorvall GSA rotor) for 10 min. transfer the supernatant to a new tube containing 1/5 volume of PEG/NaCl to precipitate the phage. Incubate for 5 min at room temperature.

( 9 ) Centrifuge in a Sotvall GSA rotor for 10 min at 4°C and 16000 g. Remove the supernatant. Remove the supernatant. Centrifuge briefly again and pipette the supernatant residue. Resuspend the phage pellet in 1/20 volume of PBS.

( 10 ) Centrifuge for 5 min at 4°C and 27000 g (15000 r/min in Sorvall SS-34 rotor) to remove insoluble impurities. Transfer the supernatant to a clean tube.

( 11 ) Estimate the phage concentration using a spectrophotometer (the phage concentration in solution at optical density [ OD268 ] = 1.0 at 268 nm is approximately 5 X 1012 phages/ml; see Note 8).

3.2.4 Preparation of E. coli SS320 Electroporation Receptors

The following protocol produces approximately 12 ml of highly concentrated E.coli SS320 electroporation sensory state (approximately 3 X 1011 cfn/ml ). Cells can be stored at -70°C for long periods of time.

( 1 ) Inoculate a single clone of E.coli SS320 strain grown in fresh LB/tet dishes in 1 ml of 2YT/tet medium. Incubate at 200 r/min on a shaker at 37°C for 6-8 h. Incubate at -70°C.

( 2 ) Transfer the culture solution to a 2 L conical flask with 500 ml of 2YT/tet medium and incubate overnight at 37°C with shaking at 200 r/min.

( 3 ) Inoculate six 2 L flasks, each containing 900 ml of Superbroth/tet medium (see 12.2.1.4) with 5 ml of the above overnight culture. Incubate at 37°C with shaking at 200 r/min until the OD550 is approximately 0.8.

( 4 ) Cool 3 conical flasks on ice for 5 min with occasional shaking. The following steps (5 )-(12) should be performed in a cold room and on ice, and all solutions and instruments used should be pre-cooled.

( 5 ) Centrifuge in a Sorvall GS-3 rotor at 4°C and 5000 g (5500 r/min) for 10 min. Remove the supernatant and add the remaining culture solution from the other 3 flasks (all liquids should be pre-cooled). Repeat the centrifugation and supernatant removal procedure.

( 6 ) Add 1.0 mmol/L HEPES, pH 7.4, to the centrifuge bottle, along with a sterilized magnet stir bar to help resuspend the centrifuged cells. Shake to dislodge the precipitate from the wall of the tube and stir magnetically at a moderate speed to completely resuspend the cellular precipitate.

( 7 ) Centrifuge in a Sorvall GS-3 rotor at 4°C and 5000 g (5500 r/min) for 10 min. remove the supernatant, being careful with the magnet stir bar in the tube. Carefully keep the tube in place when removing it from the rotor to avoid disturbing the cell deposit at the bottom of the tube.

( 8 ) Add 1.0 mmol/L HEPES, pH 7.4, to the centrifuge vial. resuspend the cell precipitate and repeat the resuspension and centrifugation procedure in steps (6) and (7). Remove the supernatant.

( 9 ) Resuspend each tube of cell sediment in 150 ml of 10% ultrapure glycerol. Do not mix the tubes.

( 10 ) Centrifuge in a Sorvall GS-3 rotor at 4°C and 5000 g (5500 r/min) for 15 min. remove the supernatant and remove the magnetic stir bar. Carefully aspirate the remaining supernatant with a pipette.

( 11 ) Add 3.0 ml of 10% ultrapure glycerol to a centrifuge tube and resuspend the cell sediment by careful aspiration (pipette). Transfer the suspended cells to another centrifuge tube and repeat the process until all cells are well suspended.

( 12 ) Quickly freeze a 350 μl portion of sensory cells in liquid nitrogen and store at -70°C.

3.3 Selection and analysis of P8 mutants that increase fusion protein expression levels

3.3.1 Selection of phage from the hGH-P8 library

The hGHbp was encapsulated on a 96-well Maxisorp immunoplate as bait, and phages from the hGH-P8 library mentioned above were screened by multiple rounds of binding experiments [16]. With the help of M13KO7 helper phage, phages were proliferated in XL-1 Blue for subsequent screening.

1 ) Coating 96-well Maxisorp plate with target protein

( 1 ) Coat 8 wells of a 96-well Maxisorp plate with 100 μl of 5 μg/ml target protein (e.g., hGHbp) and incubate at 4°C overnight. Pour the 96-well plate directly into the sink to remove the solution from the wells.

( 2 ) Add 200 μl of 0.2% BSA in PBS to each well to prevent non-specific binding of other proteins to the Maxisorp plate and shake for 1 h at room temperature.

2 ) Selection of phage library

( 1 ) Add a certain amount of phage library (about 1012 phage/ml) in PBS-T-BSA buffer to each of the above wells. Shake at room temperature for 2 h . The 96-well Maxisorp plate was then washed 8 times with PBS-T buffer. The stringency of the binding screen can be adjusted by increasing the number of washes in subsequent screens.

( 2 ) Add 100 μl of 100 mmol/L HCl to each well to elute bound phage. Shake vigorously for 5 min at room temperature.

( 3 ) Collect all eluates together and neutralize by adding 1/5 volume of 1.0 mol/L Tris-base.

3 ) Proliferate the phage for later use.

( 1 ) Add the above eluted phage mixture into 10 times volume of XL-1 Blue cells ( OD550 =0.5~1.0).

( 2 ) Incubate for 20 min at 37℃ with shaking at 200 r/min, remove 10 μl and set aside for titer measurement, refer to step (4) in section 12.3.2.3.

( 3 ) Add M13KO7 helper phage and incubate for 45 min at 37°C with shaking at 200 r/min.

( 4 ) Transfer the culture to 100 ml of 2YT/carb/kan medium and incubate overnight at 200 r/min, 37°C with shaking.

( 5 ) Isolate phage by PEG/NaCl precipitation method, refer to section 12.3.2.3, steps (8) ~ (10).

( 6 ) Repeat the above screening process 5 times, using only half of the eluted phage in each round.

3.3.2 Determination of hGH demonstration level by phage ELISA

After hGH display selection (see 12.3.3.1), the level of hGH display of individual clones relative to P8 can be determined by ELISA [ 2, 11 ]. Cis-diluted hGH- P8 phage solutions are incubated on plates containing immobilized hGHbp decoys. Unbound phages were washed away, and bound phages could be detected by spectroscopy after reaction with horseradish peroxidase-coupled M13 antibody. From the phage concentration versus 450 nm absorbance value curves, the extent to which the P8 mutant exhibits increased levels of hGH compared to wild-type P8 can be estimated by comparing the phage concentration to a specific absorbance value [11]. clones with high levels of hGH exhibition were sent for DNA sequence determination, which in turn led to the deduction of sequences of P8 mutants fused with hGH.

( 1 ) A single clone of E.coli XL-1 Blue strain containing a specific phage was picked from a fresh LB/tet plate and placed in 1 ml of 2YT medium supplemented with M13KO7 helper phage ( 1010 pfu/ml) and 50 μg/ml carboxybenzylpenicillin (to hold the phage) and 5 μg/ml tetracycline (to hold the F' add-on). in. After shaking at 200 r/min for 2 h at 37°C, 25 μg/ml kanamycin was added to select clones co-transfected with M13KO7. Shake at 200 r/min for 6 h at 37°C and transfer the culture to 30 ml of 2YT/carb/kan medium. Shake at 200 r/min, 37°C overnight.

( 2 ) Centrifuge at 4°C and 27000 g (15000 r/min in Sorvall SS-34 rotor) for 10 min. transfer the supernatant to a clean tube containing 1/5 volume of PEG/NaCl and incubate at room temperature for 5 min. centrifuge at 4°C and 12000 g (10000 r/min in Sorvall SS-34 rotor) for 10 min. remove the supernatant. Centrifuge at 4°C and 12000 g (10000 r/min, Sorvall SS-34 rotor) for 10 min. Centrifuge briefly at 2000 g (4000 r/min) and pipette the supernatant residue.

( 3 ) Resuspend the phage precipitate pellet in 0.5 ml of PBS-T-BSA buffer and transfer it to a 1.5 ml EP centrifuge tube. Centrifuge in a tabletop centrifuge at 14,000 g for 5 min and transfer the supernatant to a new 1.5 ml EP centrifuge tube.

( 4 ) Estimation of phage concentration using spectrophotometric method.

( 5 ) Prepare a 5-fold serial dilution of phage reservoir with PBS-T-BSA buffer.

( 6 ) Transfer 100 μl of phage solution to a 96-well Maxisorp immunoplate with hGHbp encapsulation and BSA blocking (see 1) in 12.3.3.1). Incubate for 1 h with gentle shaking.

( 7 ) Remove the phage solution and wash the plate 8 times with PBS-T buffer.

( 8 ) Add 100 μl of horseradish peroxidase/anti-M13 antibody complex (diluted 3000 times with PBS-T-BSA buffer, see 12.2.2.2). Incubate for 30 min with gentle shaking.

( 9 ) Wash 8 times with PBS-T buffer and twice with PBS.

( 10 ) Develop a 96-well immunoplate with 100 μl of TMB substrate solution. The reaction was terminated with 100 μl of 1.0 mol/L H3PO4 solution and the absorbance value at 450 nm was read in a 96-well plate reader.



For more product details, please visit Aladdin Scientific website.

https://www.aladdinsci.com/

Categories: Protocols
Explore topics: protein experiment

Da — when not otherwise indicated, molecular weight units are daltons.   Mw — weight-average molecular weight.   Mn — number-average molecular weight.

Products are supplied for research and development use only. Not for use in humans, animals, diagnosis, or therapy.

Cite this article

Aladdin Scientific. "M13 Experiments on the application of phage coat protein modification in improved phage display technology" Aladdin Knowledge Base, updated Dec 23, 2024. https://www.aladdinsci.com/us_en/faqs/m13-experiments-on-the-application-of-ph-en.html
Was this article helpful? Yes No 1 out 2 found this helpful

Shall we send you a message when we have discounts available?

Remind me later

Thank you! Please check your email inbox to confirm.

Oops! Notifications are disabled.