The store will not work correctly when cookies are disabled.
JavaScript seems to be disabled in your browser. For the best experience on our site, be sure to turn on Javascript in your browser.
224,000+ research products · Triple ISO certified · COA & SDS available for every product · Same-day shipping on in-stock items MicroRNA Mimic Negative Control - BioReagent,≥90%(HPLC) , CAS No.M659388
GRADE & PURITY BioReagent ? BioReagent grade — tested suitable for life-science and molecular-biology use. Use for cell culture, assays, and biochemical work needing biological compatibility. ≥90%(HPLC) Synonyms
miRNA mimic negative control | miRNA mimic NC | Negative control mimic | Scramble mimic | Scrambled miRNA mimic | Non-targeting miRNA mimic | Nonspecific miRNA mimic | Control mimic | miR-NC mimic | miR-scramble | NC mimic
Storage
Store at -20°C,Avoid repeated freezing and thawing
Shipped In
Ice chest + Ice pads
🧪
Why this grade BioReagent,≥90%(HPLC) BioReagent for sensitive chromatographic and analytical workflows requiring minimal baseline interference.
🌡
Storage & shipping Store at -20°C,Avoid repeated freezing and thawing Ships Ice chest + Ice pads Check lot-specific COA for exact specifications.
📋
Quality documents SDS, COA, datasheet, and spec sheet available for download. Lot-specific COA accessible via lot number lookup.
📚
Literature proof Cited in 0 peer-reviewed publications across chromatography, organic synthesis, and cross-coupling reactions.
Overview MicroRNA Mimic Negative Control is a 22-nucleotide miRNA mimic and serves as a negative control.
Purification: HPLC
Sense sequence (5'→3'): UUUGUACUACACAAAAGUACUG
Antisense sequence (5'→3'): GUACUUUUGUGUAGUACAAAUU
Specifications Synonyms
miRNA mimic negative control | miRNA mimic NC | Negative control mimic | Scramble mimic | Scrambled miRNA mimic | Non-targeting miRNA mimic | Nonspecific miRNA mimic | Control mimic | miR-NC mimic | miR-scramble | NC mimic
Specifications & Purity
BioReagent, ≥90%(HPLC)
Stability And Storage
Store at -20℃ long term (12 months). Upon reconstitution, it is recommended to aliquot. Avoid freeze/thaw cycle.
Storage
Store at -20°C, Avoid repeated freezing and thawing
Shipped In
Ice chest + Ice pads
This product requires cold chain shipping. Ground and other economy services are not available.
Names and Identifiers Molecular Weight 13332.58
Documentation 📋 Safety Data Sheet (SDS) Comprehensive hazard, handling, storage, and regulatory compliance document.
Download SDS → ✅ Certificate of Analysis (COA) Lot-specific quality data. Enter your lot number to retrieve the exact COA.
Look up COA → 📊 Datasheet Quick-reference summary of product specifications and applications.
View datasheet → 🔬 Specification Sheet Full quality attributes and acceptance criteria for this grade.
View spec sheet →
Advanced Data Certificates(CoA,COO,BSE/TSE and Analysis Chart) Documents & Articles Solution Calculators Molarity Calculator Determine the necessary mass, volume, or concentration for preparing a solution.
Dilution Calculator Determine the dilution needed to prepare a stock solution.
Reconstitution Calculator Reviews Need help choosing the grade? Our grade selection guide covers purity, stabilizer status, and application suitability for all variants in our catalog.
View BioReagent grade guide → Related Products MicroRNA Inhibitor Negative Control - BioReagent,≥90%(HPLC) , CAS No.M1481004
MicroRNA Antagomir Negative Control - BioReagent,≥90%(HPLC) , CAS No.M1481003
MicroRNA Agomir Negative Control - BioReagent,≥90%(HPLC) , CAS No.M1481002
hsa-miR-181b-5p mimic - BioReagent,≥90%(HPLC) , CAS No.H1491013
hsa-miR-181b-5p antagomir - BioReagent,≥90%(HPLC) , CAS No.H1470995
hsa-miR-181b-5p inhibitor - BioReagent,≥90%(HPLC) , CAS No.H1487881
hsa-miR-181b-5p agomir - BioReagent,≥90%(HPLC) , CAS No.H1458054
We use cookies to ensure the website functions properly and, where permitted, to improve your experience. You can manage your preferences at any time in Settings. Learn more in our
Cookie Policy. Settings Agree All Decline
Shall we send you a message when we have discounts available?
Remind me later Allow
Thank you! Please check your email inbox to confirm.
Oops! Notifications are disabled.
Products are supplied to verified businesses, institutions, and qualified professionals for research and development use only. Not for use in humans, animals, diagnosis, or therapy.
Copyright © 2023–present Aladdin Scientific Corp. All rights reserved.