In addition to cDNA microarrays, cDNA macroarrays based on nylon membrane supports are another widely used method for collecting large-scale gene expression data. From the discovery of new genes to the analysis of gene expression profiles, cDNA macroarrays have been used in various fields of molecular biology research. Although the dot density of cDNA macroarrays is lower than that of microarrays, macroarrays are still suitable for the detection of large-scale gene expression due to the application of isotope-labeled cDNA probes with higher sensitivity. In organs with large differences in mRNA expression, such as plant meristems and animal brains, cDNA macroarrays are a suitable method for obtaining gene expression profiles. This chapter describes the application of cDNA macroarray hybridization, including how to prepare macroarrays of different sizes, how to analyze the results of the experiments, and how to determine the significance of statistical differences in gene expression data.
Written by Martin, this experiment is from "Environmental Genomics Laboratory Guide".
Operation method
Experimental isolation of ozone-responsive genes from Arabidopsis thaliana by the cDNA macroarray approach Move ## I. Sample preparation for cDNA macroarrays Caveat 1. All reagents must be prepared in double-distilled water with a resistance higher than 17. 6. 2. Glassware used for RNA extraction must be baked at 180°C for at least 8 h to inactivate RNase. All solutions except buffer should be prepared in 0 -1 % DEPC water (see Note 3). The main source of RNase contamination is the hands of the experimenter, so disposable gloves are required for RNA experiments. 3. DEPC reacts rapidly with amines, so it should not be used to prepare solutions containing buffer components such as Tris. RNase-free solutions can be prepared with freshly opened Tris crystals. 4. DEPC may cause cancer and should be used with caution. DEPC may be carcinogenic and should be used with caution. 5. The concentration of RNA can be determined by taking an OD26 measurement of a portion of the final product. A solution with an OD26 q of 1 contains approximately 45/ig/mL of RNA. 6. Methylated dCTP (5'-methyl dCTP) is substituted for dCTP in the first-strand synthesis of cDNA to prevent cleavage of the XAo I site within the fragment. 7. Since the gene II endonuclease (M13 gpH protein; LifeTechnologies) of S. pyogenes Fl is no longer produced, it can be replaced by the site-specific endonuclease N.BstT9 (BIORON GmbH, Ludwigshafen, Germany). The reaction system consisted of 5 pg of plasmid DNA, 20 U of N.BstT9 and N.BstT9 buffer [BI0 R0 N GmbH, 10 mmol/L Tris-HCl, pH 8. 5, 10 mmol/LMgCl2, 150 mmol/L KC1, I minol/L DTT, 0 -I mg/mL bovine serum albumin (BSA)] were mixed and the volume was adjusted to 50 ^ xL with water, and the reaction was carried out for 30 min at 55°C. The selected clones were then analyzed and the reaction was completed. 8. The number of clones selected depends on the genome size and/or the purpose of the experiment. If a good set of Arabidopsis cDNA is to be prepared (the whole Arabidopsis genome size is about 1. 25 XIO8 bp), no less than 3 X 106 clones have to be selected from the homogenized cDNA library (the average length of cDNA is about 2kb). Overall, to obtain a good set of cDNAs, it is generally necessary to select clones 5 times the size of the genome. 9. When comparing multiple sets of gene expression data, the membranes used for macroarrays are often reused. Cooking the membranes with 1 % SDS for 30 min effectively elutes them. Because of the physical damage to the membrane and the amount of cDNA lost, the membrane should not be reused more than five times. Homgerg et al. used a milder method (I6). Since the shorter cDNA strands also have relatively low unwinding temperatures, after oxidative degradation, their method allows for elution at relatively low temperatures, thus minimizing temperature-induced damage. According to their paper, even if the same membrane is eluted 10 times with this method, no loss can be detected. 10. The hybridization efficiency of macroarray membranes is affected by the accuracy of the probe, the quality of the RNA, and the number of times the membrane is reused. Experiments can be done well with high quality RNA and new membranes and the hybridization system described in 3. 3. However, when the signal strength is weak or the membrane is used for other purposes, it is recommended that the membrane elution temperature should be lower than 65°C. For example, when c DNA macroarrays prepared from the Arabidopsis d DNA library are used to detect gene expression profiles of other species, such as mustard (outside Brassica na) or wheat (unpublished data), it is recommended that the elution temperature should be lower than 42°C. In contrast, if the signal intensity of all spots is low, the membrane should be eluted at a temperature of less than 65°C. On the contrary, if the signal intensity is strong at all points, the temperature can be raised for another elution. 11. In 3, we proposed a global homogenization method to homogenize the array signals, but a more accurate method (lognormal distribution fitting method) has just been published to assess data quality and homogenization (17). For more product details, please visit Aladdin Scientific website.
Medium: I : 2 (V7 V) Gamborg B5 medium (GibcoBRL, Rockville, MD), I : 1000 (V/V) Hyponex fertilizer (Hyponex 10 : 5 : 10; Hyponex Japan, Osaka, Japan), 1 % dextrose; pH adjusted to 5. 7.
##II. cDNA macroarray probe preparation (see Notes 1 to 4)
1.4 mol/L guanidium thiocyanate solution: 4 mol/L guanidium thiocyanate, 0-1 mol/L Tris-HCl, p H 7.5, l0 mmol/L EDTA, 0.5 % dodecyl sarcosine, 0.5 % dextrose; pH adjusted to 5.7. 5 % sodium dodecyl sarcosinate, 0.1 % β-hydroxyethanol
2. Phenol-chloroform: 50% (V. V) liquid phenol, pH 8.0, 48% (VvV) chloroform, 2% (V/V) isoamyl alcohol.
3.5.7 mol /L [Cesium chloride pad: 5.7 mol/L Cesium chloride, 0.1 mol/LEDTA, pH 7.5.
4.DEPC water : 0 . 1 % diethyl pyrocarbonate (DEPC).
5.10X hybridization solution: 1.2 mol/L NaCL 0.1 mol/L Tris-HCl, pH 8.0, 50 mmol/L EDT A , 10 % sodium dodecyl sulfate (SDS).
6. BPB solution: lOmmol/L Tris-HCl, p H 7.5, 0.25% bromophenol blue, l mmol/L EDTA, pH 8.0, 60 % (V/V) glycerol.
7. alkali solutions: 0. 5 mol/L NaOH, I.5 mol/L NaCl.
8. Neutralization solution: I.5 mol/L NaCl, 0.5 mol/L Tris-HCl; pH adjusted to 7.4.
9.2XSSC: 300 mmol/L NaCl, 30 mmol./L sodium citrate.
##cDNA Macroarray Hybridization
1.5 XM-MLV RT buffer: 250 mmol/L Tris-HCl, pH 8.3, 375 mmol/L KC1, 15 mmol/L MgC^ 0
2. dNTP mixture without dCTP: 20 mmol/L dATP, 20 mmol/L dTTP, 20 mmol/L dGTP.
3. Hybridization solution (Church's phosphate buffer): 0.5 mol/L Na<sub>2</sub>HPO<sub>4</sub>, 1 mol/L EDTA, 1 μg/mL poly dA (Roche Diagnostics, Indianapolis, IN). Indianapolis, IN), 7 % SDS, pH adjusted to 7. 2.
4.0.2 XSSC: 30 mmol/L NaCl, 3 mmol/L sodium catalase.
##IV. Methods
###1 Sample preparation for cDNA macroarrays
(1) The cDNA macroarrays were prepared by selecting the sis Heyhn accession Columbia ( Col-O; Col-O), which is a member of the Mustard family.
ABRC, Columbus, OH).
(2) Plants used to construct the cDNA library were cultured in soil at 22°C under a 16-h light: 8-h light-avoidance cycle.
(3) Aboveground parts of plants were collected after 2 to 6 weeks of growth, including flower buds and green fruit pods. For water culture of plants, sterilized seeds were dispersed into the medium and cultured at 22°C under uninterrupted light and rotation for 2 weeks. Seedlings and roots were collected from hydrocultured plants.
(4) For mRNA extraction, the plants were first germinated on asbestos blocks and cultured in a leaf chamber at 25°C, 50 % to 60 % relative humidity, 100 pmol HT2 s-1 photoproduction flux density (PPFD), and 14 h of light: 10 h of light-avoidance cycle.
(5) Plants were irrigated with a 2000-fold dilution of 5:10:5 nutrient solution (Hyponex, Hyponex Japan). Two-week-old plants were treated with 200 nL.L O3 in an ozone leaf chamber for 12 h (7). The ozone leaf chamber was maintained at 25°C, 70 % relative humidity, and 100 (umol DT2sH PPFD under continuous light culture conditions. Plants cultured in ambient air served as controls for the experiment. Ozone was generated by an ozone generator (Sumitomo Seika Chemical, Tokyo, Japan).
###Probe preparation for ##2 cDNA macroarrays (8)
#### (1) Poly (A )+ R N A extraction
1. Total RNA was extracted from aboveground parts, buds, roots, 2- to 6-week-old plants, and hydroponically grown seedlings using guanidinium bisulfate-cesium chloride ultracentrifugation (9).
2. Take % frozen tissue, grind it into powder in liquid nitrogen, and add 25 mL of 4 mol/L guanidinium thiohydrate buffer to it.
3. Homogenize at room temperature and centrifuge at 5000 g for 10 min.
4. Transfer the supernatant to a new centrifuge tube and add an equal volume of acid-chloroform and mix well.
5. Centrifuge at 5000 g for 5 min at room temperature.
6. Transfer the supernatant to a new centrifuge tube and repeat steps 4 and 5 four times.
7. Remove the supernatant and place it on top of a cesium chloride cushion (15 m L , 5.7 mol/' L ) in the centrifuge tube, and centrifuge at 271,000 g for 22 h at 20°C with a centrifuge rotor of RP50VF (Hitachi Koki, Tokyo, Japan).
8. Dispose of the supernatant of the centrifuge tube and place the tube upside down on a paper towel to remove the excess liquid.
9. Wash the precipitate with 70% ethanol at room temperature, discard the supernatant and aspirate the excess liquid.
10. Dry the RN A precipitate and dissolve it in DEPC water.
11. Poly.(A )+ RNA was isolated from total R N A using an mRNA purification kit (Amersham Biosciences, Piscataway, NJ) (see Note 5).
####(2) c D N A library construction
1. 1.5~7.5 μg poly (A )<sup>+</sup> R N A was used as a template, amplified with oligo-(dT)<SUB>18</SUB> primers with an Xho I site, and then reversed by Superscript H (Invitrogen, Groningen, Netherlands). The first strand was synthesized by reaction with Superscript H (Invitrogen, Groningen, Netherlands) reverse transcriptase at 52°C for 30 min (see Note 6).
2. After synthesis of the second strand, the cDNA ends were flattened with a DNA Blunting Kit (TaKaRa Bio, Ohtsu, Japan), and an EcoRI connector was added at each end.
3. Digest the cDNA with XAo I and cut out the XAo I sticky end site at 3 ¾ of the cDNA.
4. 1 % agarose electrophoresis was performed to separate the synthesized cDNA, and fragments with sizes ranging from 1 to 3 kb were recovered with a QIA-quick Gel Extraction Kit (QIAGEN, Diisseldorf, Germany).
5. The recovered fragment was ligated into pBluescript II vector via E<sub>CO</sub>RⅠ-XhoⅠ site and electrotransformed into E.coZz'XLl-Blue MRF』 strain (Stratagene).
####(3) c DNA library homogenization
1. Construct a single-stranded library with S jtZg plasmid DNA. First, a nick was generated at the f l replication initiation site of plasmid D N A by treatment with 20 units of phage F l of gene I I endonuclease (M13 gpn protein; Life Technologies, Gaithersburg, MD) at 37°C for 30 min (see Note 7). Single-stranded plasmids were then obtained by enzymatic digestion with 250 units of exonuclease m (NewEnglandBi0Iabs) with 3' to 5' exonuclease activity. The whole reaction was done in buffer (TaKaRa Bio, 50 mmol/L Tris-HCl, pH 8.0, 5 mmol/L MgCl2, 10 mmol/L 2-mercaptoethanol), which was adjusted to a total volume of 50 L by force-water, and incubated for 1 h at 37°C. The reaction was carried out in a buffer with a total volume of 50 L. The reaction was then incubated for 1 h at 37°C.
2. The cDNA insert fragment amplified by PCR was autohybridized by adding an excessive amount of cDNA insert fragment (about 1μg). To amplify the cDNA insert, use about 5 ng of DNA template (single-stranded library obtained from step 1) with I fiL 100 fxmol/L T7 primer 5'-TAATACGACTCACTATAGG0 3』 and 1 卩 L 100/imol/L SK primer 5』-GCTCTAGAACTAGTGGATC- 』.
3. Mix, add Ex-TaqrDNA polymerase (TaKaRaBio) and perform the PCR reaction on a Perkin-Elmer 9600 Thermal Cycler (Applied Biosystems, Foster City, CA) with the following program: 7 min from room temperature to 94°C; 20 cycles of 94°C I min each. I min at 94°C, 2 min at 55°C, and 3 min at 72°C per cycle, with a final extension of 72°C for 7 min.
3. PCR products were precipitated with ethanol, dissolved in 1.5 water, and then mixed with single-stranded library cDNA (50 ng) dissolved in 5 juL of formamide, 0 -5 (10 hong) 5'-end closed oligonucleotide mixtures (^GCTCTAGAACTAGTGGATCCCCCGGGGCTGCAGGAATTCG^ and 5,- AATTCGGCACGA0, -AATTCGGCACGA0 and 5,-AATTCGGCACGA0, -AATTCGGCACGA0 and 5, -AATTCGGCACGA0 and 5, -AATTCGGCACGA0. AATTCGGCACGA0 3 ') and 0.5 (10 tons) 3, closed oligonucleotide mixtures (5'-CTCGAGGGGGGGGGCCCGGGTA-3' and 5'- GTACCCAATTCGCCCTATAGTGAGTCGT A T T A - 3 ,) were mixed. 4 - The mixtures were placed at 80°C for 3 min, and the mixtures were added to I IOX for 3 min. min, add I IOX hybridization buffer and I.5 fxL of water, and react at 30°C.
The reaction was carried out at 30°C for 24 h.
5. the remaining plasmid D N A single-stranded loop was purified by hydroxyapatite chromatography and then (1 0 ) converted to double-stranded DNA using Klenow fragments (TaKaRa Bio). the resulting double-stranded D N A was then electrotransformed into £ . in. Homogenized libraries typically have IXlO6 independent clones.
####(4) Plate preparation and sequencing
1. Plasmid DNA is extracted in % well plates by alkaline lysis (11).
2. The clones were digested with A button 1 1 and Sma I. The digested products were subjected to agarose electrophoresis to obtain the inserted fragments and to determine the fragment length.
3. The clones were subjected to nucleic acid sequencing with the BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems) and electrophoresed on a DNA automated sequencer (ABI PRISM 373 and 377XL; Applied Biosystems).
4. cDNA clones were randomly selected from a standard cDNA library (see Note 8). In this example, a total of 14,026 clones were sequenced from the 5' end and 39,207 clones were sequenced from the 3' end. Ultimately, the 39,207 3' expressed sequence tags (ESTs) were divided into 12,028 separate groups (8).
5. 12,028 independent E S T clones were used to construct a large-scale cDNA macroarray. These E S T clones were amplified with the primers V-GTAATACGACTCACTATAGGGC-3' and 5'-TCATTAGGCA(^CCCAGGCTTTACAC-3'. PCR reactions were performed on a Perkin-Elmer 9600 Thermal Cycler (Applied Biosystems) in an 80 f/L mixture including I jJL E.coZi cells as PCR templates, I X Ex-T called buffer (TaKaRa Bio), 2. 5 mmol/L MgCl2 and 0 -2 mmoI/L dNTPs, 0.2 Mmol/L each of upstream and downstream primers, and 0 -5 units of Ex-Tag DNA polymerization.
DNA polymerase (TaKaRa Bio). The reaction program consisted of 35 cycles, each cycle consisted of unstranding at 94°C for 45 s, replication at 55°C for 45 s, and extension at 72°C for 2 min; the cycle was followed by extension at 72°C for 4 min.
6. 4 buckets of product from each reaction were electrophoresed on 1.5% agarose gel to determine the length of the EST fragments.
###Preparation of large-scale cDNA macroarrays
1. The remaining 75 μL of PCR product was mixed with 15 μL of BPB solution and dispensed onto an 8 cm x 12 cm nylon membrane (Biodyne A, Pall, East Hills, CA) using a Biomek 2000 LaboratoryAutomation Workstation (Beckman Instruments Inc., Fullerton, CA). A, Pall, East Hills, NY). The instrument's dispensing needle is capable of dispensing 2880 EST clones on the membrane, so in this case five different membranes were needed to accommodate the 2880 EST clones.
12,028 EST clones. Figure I A shows an example of a cDNA macroarray.
2. XDNA (10 mg/> μL) was spotted on the membrane as a negative control.
3. The spotted membrane was first denatured in a shallow dish containing alkali solution for 2 mm, and then transferred to neutralization solution for 2 min.
4. The membrane was washed with 2 XSSC and dried on a paper towel with the DNA side up.
5. After the membrane is dried, the E ST clone on the dot is immobilized on the membrane by UV cross-linking (1.2 J/cm<sup>2</sup>).
###4 Hybridization of cDNA macroarrays
#### (1) Allelic labeling (R N A S E )
1. Total R N A or m R N A of target samples was prepared as described in 2. In this example, total R N A was obtained from ozone-treated and untreated Arabidopsis plants.
2.10 μg total R N A [or 0.2 μg poly A<sup>(+)</sup>+ R N A ] with 2 μg Oligo-dT<sub>(12-18)</sub> (Invitrogen)
were mixed and the total volume was adjusted to 14 μL by adding DEPC water.
3. Incubate the RNA solution at 70°C for 10 min and ice bath for 2 min.
4. Add 6 μL of 5XM-ML VRT buffer, 1.5 μL of dNTP mix without dNTP, 1 μL of 0.1 mO l/L DTT, 6 μL of [α<SUP>-33</SUP>P] dCTP (spec act > 2,500 Ci/m mol; Amersham Biosciences) and 7.5 units of SuperScript II. Biosciences) and 7. 5 units of SuperScript II (Invitrogen).
5. After mixing, the reaction mixture was incubated at 37°C for 90 min. for 5 min in an ice bath.
6. Place the sample on a G--50 column (Probe Quant 050 Micro Column; Amersham Bioscience) and centrifuge at 820 g for 2 m in.
7. Collect the filtrate (about 30 μL) and denature at 95°C for 5 min.
8. Place the denatured probe on ice until use.
####(2) Hybridization
1. Place the cDNA macroarray membrane in a hybridization bag (Atto, Tokyo, Japan).
2. Pour IOm L of hybridization solution into the bag and seal the bag with a heat sealer.
3. Leave the hybridization bag unattended in a 65°C water bath for 1 to 2 h.
4. Remove the bag from the water bath and cut off one corner with scissors.
5. Add the denatured probe (3.2.1) into the hybridization solution and squeeze out as much air as possible from the bag.
6. Reseal the hybridization bag.
7. Leave the hybridization bag unattended in a 65°C water bath for at least 16 hours.
8. At the end of hybridization, cut off the corner of the hybridization bag with scissors and open the bag.
9. Transfer the membrane to a flat-bottomed plastic box containing 250 mL of 0.2X SSC, 0.1% SDS.
10. Wash the membrane by shaking gently for 15 min at 65°C (see Note 10).
11. Replace the solution with a new 250 mL of 0.2X SSC, 0.1 % SDS, transfer the box to a 65°C water bath, and shake gently for 15 min.
12. Place the membrane on a paper towel to absorb most of the liquid.
13. Wrap the membrane in plastic and place it in an imaging tray (Fuji Film, Tokyo, Japan) for not less than 12 h. The membrane was then incubated for 2 h in a water bath.
###5 Data collection and statistical analysis
1. Radiographic autofilms were scanned with a high-resolution scanner (Storm; Amersham B io scien ces) with a resolution of 50 ppm, and the signal intensity was quantified using the ArrayV ision software (Amersham B io scin ces). Figure IB shows an example of a scan.
2. The signal intensity data were exported in ".csv" format and imported into the data analysis software ^^ MicrosoftExcel Version X, Microsoft, Redmond, WA) for analysis.
3. The differences in data between membranes were homogenized using the global homogenization method (see Note 1 1 ) by averaging the intensities of all the signals on the membrane and using the ratio of the target signal intensity to the average intensity of the membrane to find the relative signal intensity. This evaluated value is thus called the expression rate.
4. Calculate the average value of the expression rate at the replicate sites before further analysis. When screening for stimulus-responsive genes (in this case ozone-responsive genes), genes with expression rates below 10-fold of the background signal (the average expression rate of the negative control X D N A ) are first removed; this expression level corresponds to 0.02% of the total RNA. In this case, this process excluded approximately 2/3 of the 12,028 ESTs.
5. Select the genes that have been treated (in this case ozone treatment, see Figure 2) with more than a 3-fold increase or down-regulation in expression for further analysis.
6. One-way analysis of variance (ANOVA) was used (significance level <0.5) to identify the results. 5) to identify genes with reproducible results that responded to the stimulus. This step involves the use of F-statistics, i.e., evaluating population variation based on information from two or more random samples, in order to test the statistical significance of differences in mR N A expression levels across experimental conditions. In this case, 205 nonredundant ESTs regulated by ozone were found, of which 157 expression was induced by ozone and 48 expression was repressed (Fig. 3) (12).
7. (Optional) If systematic clustering (1 3 ) and K-means clustering analysis are necessary, the GeneSpring software package (version 5.0, Silicon Genetics, Redwood, CA) is recommended.
8. To process the anamnesis data, gene names and annotations can be searched in the database of the Research and Tools (DART) program (http://tabacunxagr.nagoya-u.ac.jp/dart.). The genes can be classified by MATDB (http:/,mips.gsf.de/proj/thal/db/index "html). Unclassified E S Ts are then reclassified by the function postulated in the annotation description.
###6 Preparation of cDNA subarrays
Once the genes that respond to a stimulus have been screened, the preparation of a sub-array of the screened genes is very useful for further analysis. Because typically only about 1 0 % of the genes respond to the target stimulus, a sub-array is much more convenient for further experiments than a large-scale macro-array. Subarrays typically contain 100 ~ 1000 genes, but we have done a subarray with only 12 genes (14). Subarrays are very useful. For example, since Northern blotting and quantitative PCR, which are traditionally used to verify gene expression, are time-consuming and labor-intensive, subarrays can be used to verify whether a screened gene responds correctly to a target stimulus. Furthermore, subarrays can be used to compare differences in stimulus-related gene expression between mutant strains and different tissues (11).
1. Target cDNA clones can be obtained from public repositories or cloned on their own. In this example, the 157 ozone-induced ESTs of anthurium were obtained from the Kazusa DNA Institute (Kisarazu, Japan).
2. PCR amplification of the insert fragments of these E S T clones was performed using the amplification conditions described in 3. 2. 3 and the primers 5'-GTTTCCCAGTCACGAC-3' and 5'-CAGGAAACAGCTATGAC-3' (this pair of primers corresponds to the plasmid vector derived from pBR).
3. 75 pL of the above PCR product was mixed with 15 BPB solution and spotted onto a 9 cmX 12 cm nylon membrane (Biodyne A, Pall) using a Multi Pin Blotter 96 (Atto) in two replicates per sample. An example of a sub-array is shown in Figure 3.
4. XDNA (10 mg/fxL) was spotted on the membrane as a negative control.
5. The cDNA spots are immobilized on the membrane as described in 3. 3.
6. Hybridize and quantify signal intensity as described in 3. 4.
7. Subtract the average signal intensity of the negative control (XDNA) from the average signal intensity of the duplicate spots to obtain the signal intensity of each spot.
8. Select the signal intensity of the gene whose expression level has not changed after stimulus treatment as a reference standard and homogenize the signal intensity for each gene. In this example, AiTwM was chosen as a marker for homogenization because AtTwW has been shown to be unaltered in expression under stress conditions (5).
