Protocols

Isolation of genomic DNA fragment ends in high-capacity vectors (small vector PCR)

Summary

The genes of many eukaryotes contain far more DNA than a single recombinant can hold. This is especially true for most chromosomes. Therefore, it is necessary to construct a set of overlapping DNA clones whose sequential arrangement can form a stacked sequence (stacked cluster) that can encompass a large gene or target region. This experiment is based on the "Guide to Molecular Cloning, Third Edition", translated by Huang Peitang et al.

Operation method

Isolation of genomic DNA fragment ends in high-capacity vectors (small vector PCR)

Principle

The genes of many eukaryotes contain far more DNA than a single recombinant can hold. This is especially true for most chromosomes. Therefore, it is necessary to construct a set of overlapping DNA clones whose sequential arrangement can form a stacked sequence (stacked cluster) that can cover a large gene or target region.

Materials and Instruments

T4 Phage DNA Ligase Restriction Endonuclease PstⅠor NsiⅠ Heat Resistant DNA Polymerase Template DNA
Amplification buffer dNTP solution Ethanol Phenol Chloroform Sodium acetate T4 DNA ligation buffer
Agarose gels Nucleic acids and oligonucleotides Oligonucleotide cartridges Pipette tips with filters Thin-walled microcentrifuge tubes Pipettes Programmable PCR instruments Water baths or cooling units

Move

I. Materials

1. Buffers and solutions

10X amplification buffer

dNTP solution (1 mmol/L, including all 4 dNTPs (pH 8.0; PCR grade))

Ethanol

Phenol: chloroform (1:1, V/V)

Sodium acetate (3 mol/L, pH 5.2)

10X T4 DNA ligation buffer

2. enzymes and their buffers

T4 Phage DNA Ligase

Restriction endonuclease PstⅠor NsiⅠ.

Heat-resistant DNA polymerase

3. gels

Agarose gel

Nucleic acids and oligonucleotides

Oligonucleotide cassette [ 5.0 OD260/ml (~8.5 μmol/L)], solubilized with TE ( pH 7.6) 5'CATGCTCGGGTCGGGGATAGGCACTGGGTCTAGAGGGTTAGGTTCCTGC TACATCTCCAGCCT TGCA3'

Oligonucleotide (junction) primer [ 5.0 OD260/ml (~17 μmol/L)], dissolved in TE ( pH 7.6). 5'CATGCTCGGTCGGGGATAGGCACTGGTCTAGAGAG3'

Sequence-specific oligonucleotide (vector) primer [ 5.0 OD260/ml (~17 μmol/L) ]. Dissolve with TE ( pH 7.6 ).

Template DNA: Recombinant BAC, YAC or Mucoid DNA

4. Specialized equipment

Pipette tips with filter layer for automated pipettes

Thin-walled microcentrifuge tubes for amplification (0.5 ml)

Pipettes for positive controls

Programmable PCR instrument with stored amplification programs

15°C water bath or cooling unit

II. Methods

1. Digest approximately 5 μg of template DNA with PstⅠor NsiⅠ. Take a small portion of the reaction product and perform agarose gel electrophoresis to confirm that all DNA has been digested.

2. Recover the DNA using a phenol/chloroform extraction mixture and a standard ethanol precipitation method, then wash the precipitate with 70% ethanol. The tubes are inverted over a stack of tissue paper to allow the last remaining ethanol to evaporate, and then the moist DNA precipitate is dissolved in 50 μl of H2O.

3. To a sterile 0.5 ml microcentrifuge tube, sequentially add the following: 10 μl of 10X T4 DNA Ligase Buffer, 20 μl of digested DNA template, 2 μl of Oligonucleotide Box 5.0 OD260/ml, 2 μl of T4 Phage DNA Ligase 5 Weiss Units/μl, and add water to 100 μl.

Three control tubes were set up, and the system of the control tubes referred to the above recipe. One of them has no template DNA, the other has no oligonucleotide junction, and the third has no T4 DNA ligase.

4. Ligate the experimental tubes and control tubes at 15℃ for 12~16 hours.

5. In a sterile 0.5 ml microcentrifuge tube, sequentially add the following: 2 μl of 10X amplification buffer, 2 μl of 1 mmol/L 4 dNTP solution (pH 7.0), 1 μl of oligonucleotide primer 5.0 OD260/ml for the junction, 1 μl of oligonucleotide primer 5.0 OD260/ml for the vector, 1 μl of the ligated product of the experimental tubes from step 4, and 1 μl of the resistant ligation product. 1 μl of ligation product from step 4, 0.5 μl of heat-resistant DNA polymerase 5.0 units/μl, add water to 20 μl.

Three PCR controls were set up. Each control tube contains 1 μl of the control reaction solution corresponding to the ligation reaction.

6. If the PCR instrument does not have a high-temperature top shell, add a drop (~50 μl) of light mineral oil to the reaction mix to prevent evaporation of the sample during the heating and cooling cycles. Alternatively, add a drop of paraffin wax if a hot start is used.

7. Place the PCR tubes in the PCR instrument, enter the program according to the table below and start amplification.



8. remove one copy (25%) of the amplification product from each tube and analyze by agarose gel electrophoresis.


For more product details, please visit Aladdin Scientific website.

https://www.aladdinsci.com/

Categories: Protocols
Explore topics: DNA experiment

Da — when not otherwise indicated, molecular weight units are daltons.   Mw — weight-average molecular weight.   Mn — number-average molecular weight.

Products are supplied for research and development use only. Not for use in humans, animals, diagnosis, or therapy.

Cite this article

Aladdin Scientific. "Isolation of genomic DNA fragment ends in high-capacity vectors (small vector PCR)" Aladdin Knowledge Base, updated Dec 24, 2024. https://www.aladdinsci.com/us_en/faqs/isolation-of-genomic-dna-fragment-ends-i-en.html
Was this article helpful? Yes No 0 out found this helpful

Shall we send you a message when we have discounts available?

Remind me later

Thank you! Please check your email inbox to confirm.

Oops! Notifications are disabled.